Busch Lab

ZMP

zgc:103710

Ensembl ID:
ENSDARG00000043719
ZFIN IDs:
ZDB-GENE-041212-2, ZDB-GENE-041212-2
Description:
hypothetical protein LOC494039 [Source:RefSeq peptide;Acc:NP_001008582]
Human Orthologue:
C3
Human Description:
complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:
C3
Mouse Description:
complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39714 Nonsense Mutation detected in F1 DNA Not yet available
sa38301 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25698
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064202 Essential Splice Site 24 461 1 12
ENSDART00000075469 Essential Splice Site 24 320 1 11
Genomic Location (Zv9):
Chromosome 1 (position 56626687)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55410724
GRCz11 1 56080040
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTGCTGTTCTTCTGTCTTCAGCGCTCCTCACACTGTGTGACCCACTG[T/A]GAGTATTTTTAGTTTTTAATAAGTTTGAATGAAATTGTATTAATGTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39714
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064202 Nonsense 67 461 2 12
ENSDART00000075469 Nonsense 67 320 2 11
Genomic Location (Zv9):
Chromosome 1 (position 56623800)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55407837
GRCz11 1 56077198
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAAGCTTAATCGTGAAGATCTCTGTAAAGAACCACCCGAGGAAGAACT[T/A]GGAGATCCTGTCGAAAACAGTAACACTGACCGACGAAAACAATTTCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38301
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064202 Essential Splice Site 170 461 4 12
ENSDART00000075469 Essential Splice Site 170 320 4 11
Genomic Location (Zv9):
Chromosome 1 (position 56623215)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55407252
GRCz11 1 56076613
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCTGGTCTGAAGCCACTTGAAAATGCTGGAGTATCAGTGGAAATCATG[G/A]TAATCTTACTAAAATCCACTTAAACCTTCCTAGACAGTGACATTATGGGA
Associated Phenotype:
Not determined