Busch Lab

ZMP

si:dkey-114g7.4

Ensembl ID:
ENSDARG00000043718
ZFIN ID:
ZDB-GENE-060503-897
Description:
F-box only protein 46 [Source:RefSeq peptide;Acc:NP_001076300]
Human Orthologue:
FBXO46
Human Description:
F-box protein 46 [Source:HGNC Symbol;Acc:25069]
Mouse Orthologue:
Fbxo46
Mouse Description:
F-box protein 46 Gene [Source:MGI Symbol;Acc:MGI:2444918]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35820 Nonsense Mutation detected in F1 DNA Not yet available
sa9057 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3920
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064199 Nonsense 550 664 1 1
ENSDART00000131212 Nonsense 550 664 2 2
Genomic Location (Zv9):
Chromosome 15 (position 13598609)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14663102
GRCz11 15 14599059
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAATACATGCTTTCGCTTCCGGACCACATCATGGTCAACATCTTCAGCTA[T/A]CTGCCCACCCATTCTTTAGCAGCCCTCAAATGCACCTGCCATGACTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35820
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064199 Nonsense 563 664 1 1
ENSDART00000131212 Nonsense 563 664 2 2
Genomic Location (Zv9):
Chromosome 15 (position 13598570)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14663141
GRCz11 15 14599098
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTTCAGCTATCTGCCCACCCATTCTTTAGCAGCCCTCAAATGCACCTG[C/A]CATGACTTCAAGACCCTGATTGAGACCTACGGTGTGCGTGCTACAGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9057
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064199 Nonsense 640 664 1 1
ENSDART00000131212 Nonsense 640 664 2 2
Genomic Location (Zv9):
Chromosome 15 (position 13598341)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14663370
GRCz11 15 14599327
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCCTACTGGATGTGTTGTCGGCGCACAGATAAGGACACTCCTGGCTGT[C/T]GAGTTGGGCTACATGATAACAACTGGGTACAGCCATGTGAGCTGGTTCAG
Associated Phenotype:
Not determined