Busch Lab

ZMP

parvaa

Ensembl ID:
ENSDARG00000043710
ZFIN ID:
ZDB-GENE-040721-2
Description:
parvin, alpha a [Source:RefSeq peptide;Acc:NP_001002872]
Human Orthologue:
PARVA
Human Description:
parvin, alpha [Source:HGNC Symbol;Acc:14652]
Mouse Orthologue:
Parva
Mouse Description:
parvin, alpha Gene [Source:MGI Symbol;Acc:MGI:1931144]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa15318 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15318
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064187 Nonsense 265 372 9 13
ENSDART00000104069 Nonsense 265 372 9 13
Genomic Location (Zv9):
Chromosome 25 (position 16695243)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16241787
GRCz11 25 16338187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCTTTTGATACATTGTTTGATCATGCTCCYGACAAGCTGAGTGTGGTG[A/T]AGAAGGTATGAAAGAGCACAAATATTAGCTGAATTGACATCCTAAGGCAT
Associated Phenotype:
Not determined