Busch Lab

ZMP

mobkl2c

Ensembl ID:
ENSDARG00000043705
ZFIN ID:
ZDB-GENE-040704-32
Description:
mps one binder kinase activator-like 2C [Source:RefSeq peptide;Acc:NP_001002191]
Human Orthologue:
MOBKL2C
Human Description:
MOB1, Mps One Binder kinase activator-like 2C (yeast) [Source:HGNC Symbol;Acc:29800]
Mouse Orthologue:
Mobkl2c
Mouse Description:
MOB1, Mps One Binder kinase activator-like 2C (yeast) Gene [Source:MGI Symbol;Acc:MGI:2140623]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18422 Nonsense Available for shipment Available now
sa35045 Nonsense Available for shipment Available now
sa44736 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18422
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064176 Nonsense 20 216 2 4
Genomic Location (Zv9):
Chromosome 11 (position 13352350)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13109173
GRCz11 11 13166832
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGCTTGGGTCAGGTGTTCAGCAAAGACAAGACGTTTCGGCCTCGAAAR[C/T]GATTCGAACCTGGGACCCAACGTTTCGAGCTATACAAAAGAGYCCAGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35045
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064176 Nonsense 75 216 2 4
Genomic Location (Zv9):
Chromosome 11 (position 13352517)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13109340
GRCz11 11 13166999
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGATCGCTGTACATGTTGTGGATTTCTTCAATCGGATCAACCTAATCTA[C/A]GGGACAGTGAGCGAGTTCTGCACTGAGAAGAGCTGTCCCATCATGTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44736
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064176 Nonsense 187 216 3 4
Genomic Location (Zv9):
Chromosome 11 (position 13356888)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13113711
GRCz11 11 13171370
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGACATGATCTGCAGTATAGGAGCTGAGGCTCACATCAACACCTGTTAC[A/T]AACACTACTACTACTTCATCTCGGAGTTCAGCCTCATTGACCACTCTGAG
Associated Phenotype:
Not determined