Busch Lab

ZMP

bpnt1

Ensembl ID:
ENSDARG00000043684
ZFIN ID:
ZDB-GENE-040718-46
Description:
3'(2'),5'-bisphosphate nucleotidase 1 [Source:RefSeq peptide;Acc:NP_001002354]
Human Orthologue:
BPNT1
Human Description:
3'(2'), 5'-bisphosphate nucleotidase 1 [Source:HGNC Symbol;Acc:1096]
Mouse Orthologue:
Bpnt1
Mouse Description:
bisphosphate 3'-nucleotidase 1 Gene [Source:MGI Symbol;Acc:MGI:1338800]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa19227 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10404 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29313
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064144 Nonsense 8 309 2 9
ENSDART00000137450 Nonsense 8 153 2 6

The following transcripts of ENSDARG00000043684 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 9308338)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9142607
GRCz11 20 9130346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTGTGTTTTCTGTTTCAGGTGGTGTAATGGCGAGCAATCCTGCAGTGT[T/A]GATGCGGTTGGTGGCTTCGGCCCACGCTGTGGCAGAAAAGGCTGGAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19227
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064144 Essential Splice Site 158 309 None 9
ENSDART00000137450 None None 153 None 6
ENSDART00000064144 Essential Splice Site 158 309 None 9
ENSDART00000137450 None None 153 None 6

The following transcripts of ENSDARG00000043684 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 9318257)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9152526
GRCz11 20 9140265
KASP Assay ID:
2261-3990.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAACAGCCATTGCTGGAGTCATCAATCAACCTTTCTACAACTACCAGG[T/A]CCAACAGATTGATTGGTCATACATTTTACTGCTCTGTATTTTATGGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10404
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064144 Essential Splice Site 158 309 None 9
ENSDART00000137450 None None 153 None 6
ENSDART00000064144 Essential Splice Site 158 309 None 9
ENSDART00000137450 None None 153 None 6

The following transcripts of ENSDARG00000043684 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 9318257)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9152526
GRCz11 20 9140265
KASP Assay ID:
2261-3990.1 (used for ordering genotyping assays)
KASP Sequence:
AGGAACAGCCATTGCTGGAGTMATCAATCAACCTTTCTACAACTACCAGG[T/A]CCAACWGATTGATTGGTCATAYATTTTACTGCTCTGTATTTTATGGAGGT
Associated Phenotype:
Not determined