Busch Lab

ZMP

zgc:109995

Ensembl ID:
ENSDARG00000043666
ZFIN ID:
ZDB-GENE-050522-127
Description:
activator of basal transcription 1 [Source:RefSeq peptide;Acc:NP_001018383]
Human Orthologue:
ABT1
Human Description:
activator of basal transcription 1 [Source:HGNC Symbol;Acc:17369]
Mouse Orthologue:
Abt1
Mouse Description:
activator of basal transcription 1 Gene [Source:MGI Symbol;Acc:MGI:1353636]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34300 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2428
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064113 Nonsense 109 305 2 4
ENSDART00000131849 Nonsense 109 159 1 2
Genomic Location (Zv9):
Chromosome 8 (position 9033900)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8450482
GRCz11 8 8489067
KASP Assay ID:
554-2858.1 (used for ordering genotyping assays)
KASP Sequence:
ATTCCTCCAAGGATGAGACCGAAACACATGCGGAATCTCCTGAGTGCGTA[T/A]GGAGAGATCGGGAGGATCTTCTTACAGCCTGAAGGTAAAACTTCAAAAAC
Long Flanking Sequence:
ATCACTTTTAATACAAGTGTTTTTAAAAAGGTATTGAATTCAAGAGTACGCGCACAGATATTACCACTTATTTACGTTATTTTATAGATGAGACCCTCGGTAATGTGAGATTTTAATGGGTTTTTAACATCCTTCATTCCTAATTTCAGTCTCTAAACGTTGCTACATCCAATAATGTCTCTCCTGGAGACGAATGAAGTGAAAACAGACCTAGAAACACAACCTGTGTTCAGTGAAGACGAGTTAAATGACTGTAAACCAGAGAAAGATGAAGAGGAGAAAGCAGACAGTGCTGAAGAAGATGAGCAGGAGATGAACTCTGAGGAAGACATTAATGATGGTGAAGCTTTTCACATGGAGATTGAAGATGATGATGATGATGATGAAGAAGACGAGTCTGACAAGCCAAAGGGCAAGAAATGTGTTCCAGGTATCGTGTATTTGGGACACATTCCTCCAAGGATGAGACCGAAACACATGCGGAATCTCCTGAGTGCGTA[T/A]GGAGAGATCGGGAGGATCTTCTTACAGCCTGAAGGTAAAACTTCAAAAACACATAATTGAAAAGGACATCTATAAAGGTTTGTGAATTTGACTGCTGGACTGGGCAGATTTAGTGATTTGGGGGCATTAACCAATTCCATTCATGGGGCCCAACAGTCCTAAAAAGGTTGAGGGAAAGTTGGTTTTAGATTCACATACAGTAAATAGGACTTTCTCTCTAATAATATAATTTCAGCAAAGTTTTCTGTGCAAGGTCTAAATAGTGAGGTCATATTAGCAGCCAATCACTATCAAAGCACAACATTGTTCATAGTGAAATAAATGGTGCTAATGTTGTTTACAAGTCATTTTTACATTACATTTCAGATCAAATATTCATAATAACAGTGTAAATAATATAGAGAGCTTGTCACAAGTTGTAACTGAACAAATGTGCAAAATATAAAACCAACTGTACCTCAATCCTAATGTGCACCCTTTCCTCTTTTACTTAATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34300
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064113 Nonsense 226 305 4 4
ENSDART00000131849 None None 159 None 2
Genomic Location (Zv9):
Chromosome 8 (position 9029059)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8445641
GRCz11 8 8484226
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAGGCTAAGAAGGAGACCAACTTCTACCTGGCCAGCGTGGAAAAGAGC[C/T]AGAGCCTGGAGAAACTCCGGAAGAAGAGGGCGAAGAAGGGAGAGGTCGTG
Long Flanking Sequence:
ATTTCTGCTATAATTTTGAACCATTCATCTTTAGTTGGTGGCTCTTCTTTATAACATTTCTGGGTTATAGCTTTTTTACTTGTTGCCAAAAATATCTTAAATAGATATTTATTTTCCTTTTTAAGATTATCAGGAGTATCTCCTAGATAAAGTACTTCAAATGATCTAGGAATATAAGGAAACAAAAATATAATTGATGGTGTAGTGCACAATTCTTGAGCATTGACGATTCATAATTGTAATGATTTTACTGCATGTCCAAGCAATTAAATGCACTCTTGCTGACTTCTTTCATAAACTTTGAATACATTTGATTTCAAAAAGCAGTGTATTGAACAATAGCATCCCTCTCTTCCATTAAGTATCTGCACAGGTTCCAGTGGTGTCATCTCAGCGAGCGTTTGGCCTACGAACAGACAGTTTATCACCAGCGCATGAGGACCGAAATCTCTCAGGCTAAGAAGGAGACCAACTTCTACCTGGCCAGCGTGGAAAAGAGC[C/T]AGAGCCTGGAGAAACTCCGGAAGAAGAGGGCGAAGAAGGGAGAGGTCGTGGAGGAGAAAACGTGGGACTACAAACAGCGTCCTACAGAGGAGGAGATCCACCTGAAACGCTTTAAGAGCAAAGGCATTTCCAAGAAGAGCCTCCAGAAGGCGCAAGAGAAGAGCAAAAGCATCCAGGACAAAGCACAATCCAACGTATCCCTCCTGGCCAAGATCTTCAGCAGTAGCAAAGCCCGGGATTGATGCGCTGAGAACGTTCAGGTGCTTTCAGCTTTCGTTGACACCACAGAGTATAATCAAGGAGTTTTCTTGTGTATTTGAGATGCATTTTTCAGATTATTTGGCAACGTACAGATTCTAAACTCATGTTTTGCAGCATTTTTGACAGAATAGATGTAACTCACATGCAGAGTGTTCTGATTTATATATCTCAGCAGTAAAAACGCTGCACTATCATTCTGAAAAAGTCTTTATTTTCCCTTGAAAAGAAACTGAATGTCA
Associated Phenotype:
Not determined