Busch Lab

ZMP

tom1

Ensembl ID:
ENSDARG00000043638
ZFIN IDs:
ZDB-GENE-060721-1, ZDB-GENE-060721-1
Description:
Tom1 protein [Source:UniProtKB/TrEMBL;Acc:Q6DBV5]
Human Orthologue:
TOM1
Human Description:
target of myb1 (chicken) [Source:HGNC Symbol;Acc:11982]
Mouse Orthologues:
Gm5884, Tom1
Mouse Descriptions:
predicted pseudogene 5884 Pseudogene [Source:MGI Symbol;Acc:MGI:3644646]
target of myb1 homolog (chicken) Gene [Source:MGI Symbol;Acc:MGI:1338026]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa40070 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40070
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064078 Essential Splice Site 378 409 13 14
ENSDART00000078179 Essential Splice Site 355 386 12 13
Genomic Location (Zv9):
Chromosome 3 (position 27099665)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25804571
GRCz11 3 25935442
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTCATTTGTGATGCAGGAGGATGACTCTGAGGGAGTGACTAGTGAAG[G/A]TACTCTTCCTCTTCTGTTTCTGTTGTGTTGATGCTTTCTTCTGCAAATTA
Associated Phenotype:
Not determined