Busch Lab

ZMP

tmem205

Ensembl ID:
ENSDARG00000043604
ZFIN ID:
ZDB-GENE-070112-1692
Description:
Transmembrane protein 205 [Source:UniProtKB/Swiss-Prot;Acc:A1L2F6]
Human Orthologue:
TMEM205
Human Description:
transmembrane protein 205 [Source:HGNC Symbol;Acc:29631]
Mouse Orthologue:
Tmem205
Mouse Description:
transmembrane protein 205 Gene [Source:MGI Symbol;Acc:MGI:3045495]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa40012 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7317 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6148 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40011 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40012
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064028 Essential Splice Site None 188 None 4
ENSDART00000137099 Essential Splice Site None 188 None 4
ENSDART00000139990 Essential Splice Site None 188 None 5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 13605234)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14349390
GRCz11 3 14499190
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGGATTAACCCAAACTGATCACACAGAACCAGGCGTAGAGCGACCGGG[T/A]ATGTATTTTCTATAAACCGACAGAGTTTACAGTTGGAGGGAAATTGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7317
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064028 None None 188 None 4
ENSDART00000137099 None None 188 None 4
ENSDART00000139990 Essential Splice Site None 188 2 5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 13604440)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14350184
GRCz11 3 14499984
KASP Assay ID:
554-4390.1 (used for ordering genotyping assays)
KASP Sequence:
CCGCCAACTWTTCCAGCATTTGTTTTACGCAGTGGATGGCCTTCCAGCCG[T/C]AAGKCAGTACTGGAAAACACCTATAAACACTCATTCTCNNNNACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6148
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064028 None None 188 None 4
ENSDART00000137099 Essential Splice Site None 188 2 4
ENSDART00000139990 None None 188 None 5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 13601667)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14352957
GRCz11 3 14502757
KASP Assay ID:
554-3769.1 (used for ordering genotyping assays)
KASP Sequence:
TGCTCTTTGAGGTTTTAATCTTAATTAAATTGCTTCTTTTTCTATTTATA[G/T]AACATTTTTTCTTTACAGAAAGATAATTATGGCTACTGAGGGAGATCCGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5190
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064028 Essential Splice Site 34 188 None 4
ENSDART00000137099 Essential Splice Site 34 188 None 4
ENSDART00000139990 Essential Splice Site 34 188 None 5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 13601537)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14353087
GRCz11 3 14502887
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGATTTCCTTCACTTGGGGAATGCAGGTGTGGGTGTCTTTCATAGCAGG[T/G]AAGCAAACTTGTATGAAAACTAAACAKAAATRCAGTCGATGCATGCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40011
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064028 Nonsense 127 188 4 4
ENSDART00000137099 Nonsense 127 188 4 4
ENSDART00000139990 Nonsense 127 188 5 5

The following transcripts of ENSDARG00000043604 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 13597299)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 14357325
GRCz11 3 14507125
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACAGAGAATATGCTGGTCATGCAGGAGATCGAGAAGGAGCACGGTCTG[G/T]GAAATCAAGTGGGCATGAGCTCCAACAGGGAAGGATACACCAAACTGCGT
Associated Phenotype:
Not determined