Busch Lab

ZMP

si:ch211-127h20.2

Ensembl ID:
ENSDARG00000043593
ZFIN ID:
ZDB-GENE-081105-26
Description:
Novel protein similar to vertebrate Rap guanine nucleotide exchange factor (GEF) 1 (RAPGEF1) [Source
Human Orthologue:
RAPGEF1
Human Description:
Rap guanine nucleotide exchange factor (GEF) 1 [Source:HGNC Symbol;Acc:4568]
Mouse Orthologue:
Rapgef1
Mouse Description:
Rap guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI Symbol;Acc:MGI:104580]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa14124 Nonsense Available for shipment Available now
sa41138 Nonsense Mutation detected in F1 DNA Not yet available
sa17359 Essential Splice Site Available for shipment Available now
sa10846 Nonsense Available for shipment Available now
sa18908 Nonsense Mutation detected in F1 DNA Not yet available
sa34334 Nonsense Mutation detected in F1 DNA Not yet available
sa27140 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14124
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Nonsense 249 1085 6 25
ENSDART00000139947 Nonsense 241 1077 5 24
Genomic Location (Zv9):
Chromosome 8 (position 12348729)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11793492
GRCz11 8 11831197
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAGGAAGTAGCCCCTCCGAAACCCCCTCTACCTGGACTCAAAGTGCCT[G/T]AACAACACTGGTACKTAAGCTTTACTTGRCTTTCACCACAATAACATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41138
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Nonsense 250 1085 6 25
ENSDART00000139947 Nonsense 242 1077 5 24
Genomic Location (Zv9):
Chromosome 8 (position 12348726)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11793489
GRCz11 8 11831194
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAAGTAGCCCCTCCGAAACCCCCTCTACCTGGACTCAAAGTGCCTGAA[C/T]AACACTGGTACGTAAGCTTTACTTGACTTTCACCACAATAACATTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17359
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Essential Splice Site 480 1085 9 25
ENSDART00000139947 Essential Splice Site 472 1077 8 24
Genomic Location (Zv9):
Chromosome 8 (position 12335117)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11779880
GRCz11 8 11817585
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
RCAGATCCCCCAGAGCCCCCCACCCCTGCCGGAGAAGAAGAGTCGCCAKA[G/T]TGAGTATAAAGAATTCAGAWGGGTTGTTTAGAGGAYTGCAAATCACTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10846
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Nonsense 603 1085 12 25
ENSDART00000139947 Nonsense 595 1077 11 24
ENSDART00000064017 Nonsense 603 1085 12 25
ENSDART00000139947 Nonsense 595 1077 11 24
Genomic Location (Zv9):
Chromosome 8 (position 12317643)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11762406
GRCz11 8 11800111
KASP Assay ID:
2260-0229.1 (used for ordering genotyping assays)
KASP Sequence:
TGACGCCTGCCTGTGCTTKTGCTGTCCTCCCTCTTGTTTTYCTGTAGAGC[G/T]AAAGTGCTAATGATGAAGGTGGGGAGGGTGAATACGTCAATCTGTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18908
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Nonsense 603 1085 12 25
ENSDART00000139947 Nonsense 595 1077 11 24
ENSDART00000064017 Nonsense 603 1085 12 25
ENSDART00000139947 Nonsense 595 1077 11 24
Genomic Location (Zv9):
Chromosome 8 (position 12317643)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11762406
GRCz11 8 11800111
KASP Assay ID:
2260-0229.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACGCCTGCCTGTGCTTGTGCTGTCCTCCCTCTTGTTTTTCTGTAGAGC[G/T]AAAGTGCTAATGATGAAGGTGGGGAGGGTGAATACGTCAATCTGTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34334
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Nonsense 693 1085 14 25
ENSDART00000139947 Nonsense 685 1077 13 24
Genomic Location (Zv9):
Chromosome 8 (position 12310120)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11754883
GRCz11 8 11792588
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTTTGATTGACCACGATGAGATCATGTCTCGCATAACACTAAAGCAA[G/T]AGGTAAACTTTTGCGTTCGTTATTGCATACAGTATGCACATATACAGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27141
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Essential Splice Site 868 1085 19 25
ENSDART00000139947 Essential Splice Site 860 1077 18 24
Genomic Location (Zv9):
Chromosome 8 (position 12306007)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11750770
GRCz11 8 11788475
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCAGACCAGCTGACGCTCCTCGATGCAGAGCTCTTTTATAAGATAGAG[G/A]TACAGATTCTCCAATATCTTCTTTTTTCCAAGAGATCCCTAATTTAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27140
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Essential Splice Site 993 1085 24 25
ENSDART00000139947 Essential Splice Site 985 1077 23 24
Genomic Location (Zv9):
Chromosome 8 (position 12299057)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11743820
GRCz11 8 11781525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTAGCTGTCATGTTCTGTGTGTAATGTTCCTATGTTTCCACAAAATGC[A/T]GAGGTCTCATCCTCCAGGACTTAACGTTTGTGCATCTTGGGAATCCTGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27139
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064017 Nonsense 1077 1085 25 25
ENSDART00000139947 Nonsense 1069 1077 24 24
Genomic Location (Zv9):
Chromosome 8 (position 12297274)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11742037
GRCz11 8 11779742
KASP Assay ID:
2260-0226.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCATTGTGGGAGCTTTCCTTAAAGATCAAACCCCGCAACATCACCAGG[C/T]GAAAAACAGAGCGAGAGGAAAAGACATAGCTCACAAACAAACGGCTCTCC
Associated Phenotype:
Not determined