Busch Lab

ZMP

fas

Ensembl ID:
ENSDARG00000043586
ZFIN ID:
ZDB-GENE-061019-2
Description:
Fas [Source:UniProtKB/TrEMBL;Acc:Q0PKX5]
Human Orthologue:
FAS
Human Description:
Fas (TNF receptor superfamily, member 6) [Source:HGNC Symbol;Acc:11920]
Mouse Orthologues:
Fas, Tnfrsf22, Tnfrsf23, Tnfrsf26
Mouse Descriptions:
Fas (TNF receptor superfamily member 6) Gene [Source:MGI Symbol;Acc:MGI:95484]
tumor necrosis factor receptor superfamily, member 22 Gene [Source:MGI Symbol;Acc:MGI:1930270]
tumor necrosis factor receptor superfamily, member 23 Gene [Source:MGI Symbol;Acc:MGI:1930269]
tumor necrosis factor receptor superfamily, member 26 Gene [Source:MGI Symbol;Acc:MGI:2651928]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11234 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11234
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079563 Essential Splice Site 13 293 1 8
Genomic Location (Zv9):
Chromosome 17 (position 23461122)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23611271
GRCz11 17 23631295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCCTCGAGATGTTTGTTTGCAAATTCGGCGTTTTTATCGTCTTTGTGG[T/G]GAGTAAGTCTTTGTATTRTTCAGCTTTATGTAGTRTTTTTTAGGAGAAAC
Long Flanking Sequence:
GTTTCTATTGTTTGTAAGATGTTGGGTTAATATATTTATTTTATTTTGGATGGTTTATTTTGACAAATTTCCCTAAATTACTTCAGCTTTTTACTAGTGTACTAGATTTGGAAAGTACTGTCCATTCCCAGGAAATGATGTTCTCTCGAATCGTTCATTAAAGTGAACCGGTTCAATTTCAGTGATTCATAATACACAGCTAAGAAATCATGCGCTCCCCTCCCCAAACGAATATAACCATACGACTAAAAGTGTTTCCGAGCAGAACTGTCCGAATTTTGCGAATGGACCACAGTCATAAAGCTCCTTAAGAAAATAAACATGATTCTGTTCAAAGGAATCAACTTGACTCGACTTGAATCACTGAATCACTTCCTTAAACTCATTCATTCACTTATGACTTACTGTACAGTTCATCTGACGTTCGAGATTCGCTTCTAATTCGGGTGACCTCCTCGAGATGTTTGTTTGCAAATTCGGCGTTTTTATCGTCTTTGTGG[T/G]GAGTAAGTCTTTGTATTGTTCAGCTTTATGTAGTGTTTTTTAGGAGAAACACCCCGTAGACTAAAACTACTTTGAATTGTAAACATGCGGACTTGCAGTCTCCTATAAACTTTGTACTGATAGCTGTTACATAAAAACAAAATACGTAGGAAGCCGACTGATTAAGAAAGTTAGTTAGAAATATAGTAATCAAGTAAAATAGAAATATTTATACTGTAGTAAACAACTGACTGTGTTTGTTTCACTTTCGATTTCTCAACAACACGTTGGTGTACCTCCCAAAGAAGTACATTTTAAAATATTTAATGATAATTACCCATCTTCAGAGCCTCCTTGACAAATTTAATTTTGCTTAAAATTCTGTGAGGTTGACTTTGAAACGACTGCACATTTATTTTTTTTAATGTTTATATAGCAGAACCTTTTGGTCTGATTCATTCGAGTGGTTAAAGGTTTCTCTCAAGTTGTCCTCCCAATTTCCTAAAAATGATATTTTCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4712
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079563 Essential Splice Site 47 293 2 8
Genomic Location (Zv9):
Chromosome 17 (position 23459249)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23609398
GRCz11 17 23629422
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGGAACTTACCAGCATGAGAGGAACACATGTTGCCTCTGTCCTGCAGG[T/C]AAGATAATGCATAACTTATTATGCATACAGAACTACCCCGATGTTCCTCA
Long Flanking Sequence:
TTAGAGAATGTTTTTTTTAAAATAGAGGCAAAGATGAACTTGGGCCTAGAAAAAAAGCTTTGTACTTGAGCATTGACATACAAAAAGCTAAGTTTGTTTGTAGGTATGTGCGTGTGTTTTTGAAAGTAGAAAGATTTATATTTGGCTTATTCAGTACTTTAATGTTACCCATTTATTTGTGAAATACAGTTTAATACTGCAATTAGTTACATTACAACCCTTCCCTGTTAGTCATTTTTTATTTATTATAGTTATTATAGGTGTTATTATTATTATTATTATACCCTCATTGGGACTGATGCCTGTGTCCCTAACCCAACATGCTTGAAAAAACTTAAAATAAAAGATTGCAAGTTTAAGTTAACATTTTATTTGTGAAATGCTTTTCCCATGTTTTAGATGCCCACTTTGACTTATAGCTGGCGCTTGAGACGCGATGCCTCCTGTGAGTTTGGAACTTACCAGCATGAGAGGAACACATGTTGCCTCTGTCCTGCAGG[T/C]AAGATAATGCATAACTTATTATGCATACAGAACTACCCCGATGTTCCTCAGAGATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTGGCACTGGGTGGTGCAGAAACACAGTGGGTAGTTCTGTTGCCTCACAGCAAGAAGGTCGATGGTACGAGCCTTGGCTGGGTCATATGCCATTTCTATGTGGGGTTTGCATGTTCTCTCCATGTTGGCGTGGGTTTCCTCCGGGTGCTCCGGTTTCCCCCACAGTTCAAACACATGTGTTATAAGCGAATTGGGAAAGCTAAATTGTCCATAGTGTATGCGTCTGAATGAGAATGTATGGGTGTTTCCCAGTGATGGGTTGCAGCTGAAAGGGCATATGCTGCATAAAACATATGCTGGATGACATGGCGCTTCATTCCGCTGTGGCGACCTCTAATTAATAAAGGGACTAAGCCGAAAAGAAAATGAATGAATGAACTATTGGCACTGAATTATGA
Associated Phenotype:
Not determined