Busch Lab

ZMP

ifit2

Ensembl ID:
ENSDARG00000043584
ZFIN ID:
ZDB-GENE-030131-1055
Description:
Ifit2 protein [Source:UniProtKB/TrEMBL;Acc:Q5U3W8]
Human Orthologues:
IFIT1, IFIT1B, IFIT2, IFIT3, IFIT5
Human Descriptions:
interferon-induced protein with tetratricopeptide repeats 1 [Source:HGNC Symbol;Acc:5407]
interferon-induced protein with tetratricopeptide repeats 1B [Source:HGNC Symbol;Acc:23442]
interferon-induced protein with tetratricopeptide repeats 2 [Source:HGNC Symbol;Acc:5409]
interferon-induced protein with tetratricopeptide repeats 3 [Source:HGNC Symbol;Acc:5411]
interferon-induced protein with tetratricopeptide repeats 5 [Source:HGNC Symbol;Acc:13328]
Mouse Orthologues:
2010002M12Rik, Gm14446, I830012O16Rik, Ifit1, Ifit2, Ifit3
Mouse Descriptions:
RIKEN cDNA 2010002M12 gene Gene [Source:MGI Symbol;Acc:MGI:2148249]
RIKEN cDNA I830012O16 gene Gene [Source:MGI Symbol;Acc:MGI:3698419]
interferon-induced protein with tetratricopeptide repeats 1 Gene [Source:MGI Symbol;Acc:MGI:99450]
interferon-induced protein with tetratricopeptide repeats 2 Gene [Source:MGI Symbol;Acc:MGI:99449]
interferon-induced protein with tetratricopeptide repeats 3 Gene [Source:MGI Symbol;Acc:MGI:1101055]
predicted gene 14446 Gene [Source:MGI Symbol;Acc:MGI:3650685]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa32151 Nonsense Available for shipment Available now
sa13361 Nonsense Available for shipment Available now
sa42926 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4711
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064003 Nonsense 211 449 2 2
Genomic Location (Zv9):
Chromosome 17 (position 23438255)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23588404
GRCz11 17 23608428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGCCATATCTATGAGCAAAGCATGTTTATGGTATAAATGCACTCCAGAG[C/T]AGAAAGCKGAGATTTTAGAGAAGGTGAAAACGGCAGCAGAGATCAACCCA
Long Flanking Sequence:
AAAATGAGCTGCAAGGGATGAAGAGAGAGATGGACCTTGATGTCCCACAAAAAATCTCTTCTCCAGTCCACTATTACAACCTGCTGGGCTTCATCCAAAAGAGTCTTGGCTCTGACAGAGAGGCGCTGGAGTCCCTACAGAAAGCAGAAAGTGTTATCCAGGAGCAGGGAACAGAAGAGACTGCAGTCCGGCTGCTGGTCAATAAAGCTAACATGGCTTGGGTCCACTTCCATTTGGGAGAGCTGGAGAAGAGCAGAGGATACCTAGAAGAGCTGGAGGAGCTTCAGAGAATTCATCCTGCTCCACCTGGATGCCCTTTACACCCTGAAGTGAGTGGAGAAAAGGGCTGGACGCTGGTGAAGTTCAACAAGTCCAAGAAGCGCCTGGCCATCGATTACTTTAAGATGGCTTTAGAAGCTGAACCTGAAAGGAAGGAATGGCACAAAGGTCTTGCCATATCTATGAGCAAAGCATGTTTATGGTATAAATGCACTCCAGAG[C/T]AGAAAGCGGAGATTTTAGAGAAGGTGAAAACGGCAGCAGAGATCAACCCAAATGATTTGTTACTTCAGGCTCTTTATTTAGTAAAACTTTCTTATGTGACAAAAGTAAACGTCGAGAGAGAGATGCGAGATTTACTAGAGAGATGTCTTGAAATTGTAAACGTGCCGGGTTTGAATATCATTCTCAAATATTTAGGAGACATTTCTTTTGATGAATCTATTCGTGAAGGAGAGAGATTTCAAGAAAGGTACCCCGAATCAATCAAAGTGTTGAAATGCCTGGCAGACACCTACAAATGGAAGGTTTACAAAATGAATGAAGACACAGAGGAAAGGGTGATTCTGGCTAGGAAAACCATTGAGCTGCTGGAGAAGGTTTGCGGATATAACCCAGACTCACACAGAGCAAAAGTAGCCCTTGCAGCAATGCACTATTACGCACACAACACTGAAAGAGCCGATGAGATTTACCAGCAGCTCTTGTTAGAAGAAGAATTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32151
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064003 Nonsense 294 449 2 2
Genomic Location (Zv9):
Chromosome 17 (position 23438004)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23588153
GRCz11 17 23608177
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTCTTTTGATGAATCTATTCGTGAAGGAGAGAGATTTCAAGAAAGGTA[C/A]CCCGAATCAATCAAAGTGTTGAAATGCCTGGCAGACACCTACAAATGGAA
Long Flanking Sequence:
AGCAGAGGATACCTAGAAGAGCTGGAGGAGCTTCAGAGAATTCATCCTGCTCCACCTGGATGCCCTTTACACCCTGAAGTGAGTGGAGAAAAGGGCTGGACGCTGGTGAAGTTCAACAAGTCCAAGAAGCGCCTGGCCATCGATTACTTTAAGATGGCTTTAGAAGCTGAACCTGAAAGGAAGGAATGGCACAAAGGTCTTGCCATATCTATGAGCAAAGCATGTTTATGGTATAAATGCACTCCAGAGCAGAAAGCGGAGATTTTAGAGAAGGTGAAAACGGCAGCAGAGATCAACCCAAATGATTTGTTACTTCAGGCTCTTTATTTAGTAAAACTTTCTTATGTGACAAAAGTAAACGTCGAGAGAGAGATGCGAGATTTACTAGAGAGATGTCTTGAAATTGTAAACGTGCCGGGTTTGAATATCATTCTCAAATATTTAGGAGACATTTCTTTTGATGAATCTATTCGTGAAGGAGAGAGATTTCAAGAAAGGTA[C/A]CCCGAATCAATCAAAGTGTTGAAATGCCTGGCAGACACCTACAAATGGAAGGTTTACAAAATGAATGAAGACACAGAGGAAAGGGTGATTCTGGCTAGGAAAACCATTGAGCTGCTGGAGAAGGTTTGCGGATATAACCCAGACTCACACAGAGCAAAAGTAGCCCTTGCAGCAATGCACTATTACGCACACAACACTGAAAGAGCCGATGAGATTTACCAGCAGCTCTTGTTAGAAGAAGAATTGTCTCCTGACAAGTGGCAGTATATTTACTACTGTTATGCCAGTTATCTAAATCAGTGTAAACGGTTCAGTGAGTCAGTACAGTTTCACATAAAAGGAGTGAAAACCCCAGGTGATTCAGTTGACAAAGAAAAGAGTTTAAACATTCTTAAAAAGATTGTGTGGAGAGGTAAAGATCCGCTCTGTTCAGAAATTAGGCAATTACTCAAGACAACTCAGAAATGATTTTGATAAATCTGATGAATGTAGTTTAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13361
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064003 Nonsense 313 449 2 2
Genomic Location (Zv9):
Chromosome 17 (position 23437947)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23588096
GRCz11 17 23608120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAAKCAAAGTGTTGAAATGCCTGGCAGACACCTACAAATGGAAGGTTTA[C/G]AAAATGAATGAAGACACAGAGGAAAGGRTGATTCTGGCTAGGAAAACCAT
Long Flanking Sequence:
GGATGCCCTTTACACCCTGAAGTGAGTGGAGAAAAGGGCTGGACGCTGGTGAAGTTCAACAAGTCCAAGAAGCGCCTGGCCATCGATTACTTTAAGATGGCTTTAGAAGCTGAACCTGAAAGGAAGGAATGGCACAAAGGTCTTGCCATATCTATGAGCAAAGCATGTTTATGGTATAAATGCACTCCAGAGCAGAAAGCGGAGATTTTAGAGAAGGTGAAAACGGCAGCAGAGATCAACCCAAATGATTTGTTACTTCAGGCTCTTTATTTAGTAAAACTTTCTTATGTGACAAAAGTAAACGTCGAGAGAGAGATGCGAGATTTACTAGAGAGATGTCTTGAAATTGTAAACGTGCCGGGTTTGAATATCATTCTCAAATATTTAGGAGACATTTCTTTTGATGAATCTATTCGTGAAGGAGAGAGATTTCAAGAAAGGTACCCCGAATCAATCAAAGTGTTGAAATGCCTGGCAGACACCTACAAATGGAAGGTTTA[C/G]AAAATGAATGAAGACACAGAGGAAAGGGTGATTCTGGCTAGGAAAACCATTGAGCTGCTGGAGAAGGTTTGCGGATATAACCCAGACTCACACAGAGCAAAAGTAGCCCTTGCAGCAATGCACTATTACGCACACAACACTGAAAGAGCCGATGAGATTTACCAGCAGCTCTTGTTAGAAGAAGAATTGTCTCCTGACAAGTGGCAGTATATTTACTACTGTTATGCCAGTTATCTAAATCAGTGTAAACGGTTCAGTGAGTCAGTACAGTTTCACATAAAAGGAGTGAAAACCCCAGGTGATTCAGTTGACAAAGAAAAGAGTTTAAACATTCTTAAAAAGATTGTGTGGAGAGGTAAAGATCCGCTCTGTTCAGAAATTAGGCAATTACTCAAGACAACTCAGAAATGATTTTGATAAATCTGATGAATGTAGTTTAATGTAGAATGGAGCTGTTCTCATGCAGTGTCATTTTTTAAAAACACAAAATAACGTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42926
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064003 Nonsense 394 449 2 2
Genomic Location (Zv9):
Chromosome 17 (position 23437706)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23587855
GRCz11 17 23607879
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCTGACAAGTGGCAGTATATTTACTACTGTTATGCCAGTTATCTAAAT[C/T]AGTGTAAACGGTTCAGTGAGTCAGTACAGTTTCACATAAAAGGAGTGAAA
Long Flanking Sequence:
CAAATGATTTGTTACTTCAGGCTCTTTATTTAGTAAAACTTTCTTATGTGACAAAAGTAAACGTCGAGAGAGAGATGCGAGATTTACTAGAGAGATGTCTTGAAATTGTAAACGTGCCGGGTTTGAATATCATTCTCAAATATTTAGGAGACATTTCTTTTGATGAATCTATTCGTGAAGGAGAGAGATTTCAAGAAAGGTACCCCGAATCAATCAAAGTGTTGAAATGCCTGGCAGACACCTACAAATGGAAGGTTTACAAAATGAATGAAGACACAGAGGAAAGGGTGATTCTGGCTAGGAAAACCATTGAGCTGCTGGAGAAGGTTTGCGGATATAACCCAGACTCACACAGAGCAAAAGTAGCCCTTGCAGCAATGCACTATTACGCACACAACACTGAAAGAGCCGATGAGATTTACCAGCAGCTCTTGTTAGAAGAAGAATTGTCTCCTGACAAGTGGCAGTATATTTACTACTGTTATGCCAGTTATCTAAAT[C/T]AGTGTAAACGGTTCAGTGAGTCAGTACAGTTTCACATAAAAGGAGTGAAAACCCCAGGTGATTCAGTTGACAAAGAAAAGAGTTTAAACATTCTTAAAAAGATTGTGTGGAGAGGTAAAGATCCGCTCTGTTCAGAAATTAGGCAATTACTCAAGACAACTCAGAAATGATTTTGATAAATCTGATGAATGTAGTTTAATGTAGAATGGAGCTGTTCTCATGCAGTGTCATTTTTTAAAAACACAAAATAACGTAAAAAATAGTGCTTTTACGCAGTGGTGGAAAGATTAATGAAATATCATACTTAAGTAAAAGTACCATTACTTGCCTAAAAATGTAGTGCAAGTAGAGTAAAAGTACCTGTAAATATTACTGTAAAATTTAAAATATTAATACATTTTAAAATGTAATTTATGATTAATAATTTTTTTTTTTTAAATTACTCAAAGTATGGGTAAAAAGTAGCCCTGTAATATCAGGTGACCAAAATTCAATGTCTA
Associated Phenotype:
Not determined