Busch Lab

ZMP

b3gntl1

Ensembl ID:
ENSDARG00000043431
ZFIN ID:
ZDB-GENE-050913-133
Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like protein 1 [Source:RefSeq peptide;A
Human Orthologue:
B3GNTL1
Human Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1 [Source:HGNC Symbol;Acc:21727]
Mouse Orthologue:
B3gntl1
Mouse Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1 Gene [Source:MGI Symbol;Acc:MGI:2

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39723 Nonsense Mutation detected in F1 DNA Not yet available
sa17799 Nonsense Available for shipment Available now
sa1977 Essential Splice Site Available for shipment Available now
sa39722 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39723
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063750 Nonsense 84 338 4 12
ENSDART00000104222 Nonsense 125 379 4 12
ENSDART00000143018 Nonsense 125 143 4 5
Genomic Location (Zv9):
Chromosome 1 (position 57663922)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 56639361
GRCz11 1 57354448
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCTGTAGTGGGATATGCCAAAAACCAGGCTGTGAGTCAGAGCTCGGGA[C/T]GATTCCTCTGCTTTCAGGATGCGGTGAGTGTGTGTGTGTGTGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17799
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063750 Nonsense 147 338 7 12
ENSDART00000104222 Nonsense 188 379 7 12
ENSDART00000143018 None None 143 None 5
Genomic Location (Zv9):
Chromosome 1 (position 57657437)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 56645846
GRCz11 1 57360933
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTGATCGTTTCTGNNNNNNNNTGTGTGTGTGTNNNNTGTGCAGGTCTA[C/A]ACGTCTCATGGGCCGACCGTCATCATGCCGTCCTGGTTCTGCTCGCGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1977
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063750 Essential Splice Site 312 338 11 12
ENSDART00000104222 Essential Splice Site 353 379 11 12
ENSDART00000143018 None None 143 None 5
Genomic Location (Zv9):
Chromosome 1 (position 57653994)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 56649289
GRCz11 1 57364376
KASP Assay ID:
554-2720.1 (used for ordering genotyping assays)
KASP Sequence:
TCCTTCACTTCAGAAACGCCTCGCCACCATTTATTGTGTGTGTCAAACTG[G/A]TGAGTGTGTGTTTGTGTGTGTGNNNNTGTATGTGTTAGTGTGTCTGTATGTA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa39722
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063750 Nonsense 334 338 12 12
ENSDART00000104222 Nonsense 375 379 12 12
ENSDART00000143018 None None 143 None 5
Genomic Location (Zv9):
Chromosome 1 (position 57653811)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 56649472
GRCz11 1 57364559
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCTGGAGGGAAATCTTCATTCTCTGCAGCTCACAGAGGGAGTCCATTA[C/A]TACCATTTCAACTGACGACAGTGTGTGTATGTGTGAGAGAGAGAGAGAGT
Associated Phenotype:
Not determined