Busch Lab

ZMP

si:dkeyp-72h1.2

Ensembl ID:
ENSDARG00000043416
ZFIN ID:
ZDB-GENE-041210-301
Description:
tumor necrosis factor, alpha-induced protein 2 [Source:RefSeq peptide;Acc:NP_001025387]
Human Orthologue:
TNFAIP2
Human Description:
tumor necrosis factor, alpha-induced protein 2 [Source:HGNC Symbol;Acc:11895]
Mouse Orthologue:
Tnfaip2
Mouse Description:
tumor necrosis factor, alpha-induced protein 2 Gene [Source:MGI Symbol;Acc:MGI:104960]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa32285 Nonsense Available for shipment Available now
sa23665 Nonsense Available for shipment Available now
sa13685 Essential Splice Site Available for shipment Available now
sa13324 Nonsense Available for shipment Available now
sa36998 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29327
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063736 Nonsense 58 547 2 13
ENSDART00000126959 Nonsense 58 701 2 13

The following transcripts of ENSDARG00000043416 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 18744328)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18772585
GRCz11 20 18672168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCCCAAAAAATATTAAAATGAAAAACCTTATCACAAGCAAAAGGAATT[C/A]GAAATCTGAAGCTGTCTTCAGACCGGAAGTTGTAGGTAAATGTATTAGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7930
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063736 Nonsense 240 547 4 13
ENSDART00000126959 Nonsense 240 701 4 13

The following transcripts of ENSDARG00000043416 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 18745107)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18773364
GRCz11 20 18672947
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGCAGACAAAAAATCCATGATCCACTGCTTAAGACTTTAGTGGAGAMA[C/T]GATTGAAAAATGCAGATGGACARGAGAATAAAGCAGACAAGCTGTCCACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4888
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063736 Nonsense 284 547 4 13
ENSDART00000126959 Nonsense 284 701 4 13

The following transcripts of ENSDARG00000043416 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 18745241)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18773498
GRCz11 20 18673081
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAGTACAAAAAGACCTGCTGATTGTGGTCCGAAATCTAAAGGAGTGTTA[T/A]CCAGCAGACTTTGACATCTGCAGAACATATGCTCAACTTTACCATCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32285
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063736 Nonsense 321 547 4 13
ENSDART00000126959 Nonsense 321 701 4 13

The following transcripts of ENSDARG00000043416 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 18745352)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18773609
GRCz11 20 18673192
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACTGCAAGAGCTTACCAGGTCCAGTATTGAGTTTGAGGATTGCGCCTA[T/A]ATACTGAGCTGGATAAAGATCTACTACCCAAAGTAAGATTGATGTCTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23665
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063736 Nonsense 361 547 5 13
ENSDART00000126959 Nonsense 361 701 5 13

The following transcripts of ENSDARG00000043416 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 18749580)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18777837
GRCz11 20 18677420
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACAGTTCATTACTTGGACCTCTGTTACCTGAGGAACATCTTAAAAGAT[T/A]AGAGGATCAGTACTTCTCATGCAAGGAGGTAATTTTATCAAAGTCATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13685
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063736 Essential Splice Site 370 547 5 13
ENSDART00000126959 Essential Splice Site 370 701 5 13

The following transcripts of ENSDARG00000043416 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 18749610)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18777867
GRCz11 20 18677450
KASP Assay ID:
2261-4118.1 (used for ordering genotyping assays)
KASP Sequence:
TGAGGAACATCTTAAAAGATTAGAGGATCAGTACTTCTCATGCAAGGAGG[T/A]AATTTTWTCAAAGTCATTACCAAATAGTTTTATCANNAGTCAACCTCAWA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13324
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063736 Nonsense 400 547 6 13
ENSDART00000126959 Nonsense 400 701 6 13

The following transcripts of ENSDARG00000043416 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 18749862)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18778119
GRCz11 20 18677702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGTGGATAAATGGAGTGATGGCTTTGAACCTGAGCTCATTGAAGGATG[C/A]TACTTTGGTAACCTTGCTGTCGATRTTTTRCCGGTAAGCTATGGGCTMTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36998
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063736 Essential Splice Site 411 547 6 13
ENSDART00000126959 Essential Splice Site 411 701 6 13

The following transcripts of ENSDARG00000043416 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 18749897)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18778154
GRCz11 20 18677737
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCATTGAAGGATGCTACTTTGGTAACCTTGCTGTCGATGTTTTGCCGG[T/A]AAGCTATGGGCTCTGTTGACATGCTATGCAGTATGTATTAAAAATATACA
Associated Phenotype:
Not determined