Busch Lab

ZMP

slc8a1b

Ensembl ID:
ENSDARG00000043406
ZFIN ID:
ZDB-GENE-060110-3
Description:
sodium/calcium exchanger 1 [Source:RefSeq peptide;Acc:NP_001034233]
Human Orthologue:
SLC8A1
Human Description:
solute carrier family 8 (sodium/calcium exchanger), member 1 [Source:HGNC Symbol;Acc:11068]
Mouse Orthologue:
Slc8a1
Mouse Description:
solute carrier family 8 (sodium/calcium exchanger), member 1 Gene [Source:MGI Symbol;Acc:MGI:107956]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa28843 Nonsense Mutation detected in F1 DNA Not yet available
sa36395 Nonsense Mutation detected in F1 DNA Not yet available
sa23060 Nonsense Available for shipment Available now
sa19172 Nonsense Mutation detected in F1 DNA Not yet available
sa23061 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28843
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000804 Nonsense 20 944 2 7
ENSDART00000089919 Nonsense 20 942 2 7
ENSDART00000128875 Nonsense 20 608 1 1
Genomic Location (Zv9):
Chromosome 17 (position 22211321)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22361470
GRCz11 17 22381306
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGTGAGACCTCCCCACGCCTCTTCCTGACCTTTCAGTGTCTAGTCCTTT[T/A]GGTTATAGTGGTCCACAATGTCCACCATGTGACAGCCGAACATGCCCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36395
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000804 Nonsense 192 944 2 7
ENSDART00000089919 Nonsense 192 942 2 7
ENSDART00000128875 Nonsense 192 608 1 1
Genomic Location (Zv9):
Chromosome 17 (position 22211838)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22361987
GRCz11 17 22381823
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCGGCAGTGCAGCTTTCAACATGTTTGTCATTATTGGAATCTGTGTCTA[T/A]GTGGTGCCCGACGGAGAACATCGCAAAGTGAAACACCTGCGTGTGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23060
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000804 Nonsense 462 944 2 7
ENSDART00000089919 Nonsense 462 942 2 7
ENSDART00000128875 Nonsense 462 608 1 1
Genomic Location (Zv9):
Chromosome 17 (position 22212648)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22362797
GRCz11 17 22382633
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGTGGAATTTCGCACTGAAGATGGAACCGCAAATGCTGGCTCAGACTA[T/A]GAGTTCACTGAAGGTACCGTTGTTTTCAAGCCTGGTGAGACACAGAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19172
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000804 Nonsense 562 944 2 7
ENSDART00000089919 Nonsense 562 942 2 7
ENSDART00000128875 Nonsense 562 608 1 1
Genomic Location (Zv9):
Chromosome 17 (position 22212946)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22363095
GRCz11 17 22382931
KASP Assay ID:
2261-0965.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACATTTGAAGAGCCGGTCACCCATGTGAGTGAGAGTGTGGGTGTCATG[G/T]AAGTGAAGGTCCTGCGTACGTCTGGTGCCCGTGGGGTGGTGTCAGTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23061
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000804 Nonsense 632 944 3 7
ENSDART00000089919 None None 942 None 7
ENSDART00000128875 None None 608 None 1
Genomic Location (Zv9):
Chromosome 17 (position 22302075)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22452224
GRCz11 17 22472060
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCAATCGAGAGGAGTACCATAAGCAATGCAGCTTTTTCATAGAGCTA[C/T]AGACGCCACTTTGGAGAAGGAGAGGATGGACAGTATACAGAGGTTTCTCT
Associated Phenotype:
Not determined