Busch Lab

ZMP

si:dkey-7o6.3

Ensembl ID:
ENSDARG00000043403
ZFIN ID:
ZDB-GENE-081104-436
Description:
hypothetical protein LOC564675 [Source:RefSeq peptide;Acc:NP_001107075]
Human Orthologues:
PAOX, SMOX
Human Descriptions:
polyamine oxidase (exo-N4-amino) [Source:HGNC Symbol;Acc:20837]
spermine oxidase [Source:HGNC Symbol;Acc:15862]
Mouse Orthologues:
Paox, Smox
Mouse Descriptions:
polyamine oxidase (exo-N4-amino) Gene [Source:MGI Symbol;Acc:MGI:1916983]
spermine oxidase Gene [Source:MGI Symbol;Acc:MGI:2445356]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41156 Nonsense Mutation detected in F1 DNA Not yet available
sa9825 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41156
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063718 Nonsense 126 490 2 7
ENSDART00000132216 Nonsense 126 490 3 8

The following transcripts of ENSDARG00000043403 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15761863)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15207207
GRCz11 8 15244912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGGAGAGCTTCATTTATCACCGTGGCTCGGGAAACTCAGGAAAGAGTT[T/A]AGGTGAACACTACGCAGTGAAAACCCAGGGTGTGATTGAACGTTTGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9825
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063718 Nonsense 239 490 3 7
ENSDART00000132216 Nonsense 239 490 4 8

The following transcripts of ENSDARG00000043403 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 15762271)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15207615
GRCz11 8 15245320
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATCCTTCCCTTCTCCGCAAAATGAAGCTTCTCCTGAAGGAAAAGTCCGC[C/T]AATACCCTGTTTGCATTGTCTGTGAGGATGGGGAGGAGATTCTAGCTGAT
Associated Phenotype:
Not determined