Busch Lab

ZMP

si:dkey-71h2.2

Ensembl ID:
ENSDARG00000043394
ZFIN ID:
ZDB-GENE-041014-145
Description:
Novel protein containing a phosphotyrosine interaction domain (PTB/PID) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
LDLRAP1
Human Description:
low density lipoprotein receptor adaptor protein 1 [Source:HGNC Symbol;Acc:18640]
Mouse Orthologue:
Ldlrap1
Mouse Description:
low density lipoprotein receptor adaptor protein 1 Gene [Source:MGI Symbol;Acc:MGI:2140175]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa37003 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37003
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063703 Nonsense 117 266 4 10
ENSDART00000145139 Nonsense 130 200 4 6
Genomic Location (Zv9):
Chromosome 20 (position 19365713)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19393970
GRCz11 20 19293553
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCACCCACAGTGAAAAGCTTATATTTCTCATCTCTGCAGAATATCTTA[C/A]TGCACAACAGATAAAACTCAGGATAAGGTCTTCGCCTACGTCTCCCAAAG
Associated Phenotype:
Not determined