Busch Lab

ZMP

GPX3

Ensembl ID:
ENSDARG00000043342
Description:
glutathione peroxidase 3 (plasma) [Source:HGNC Symbol;Acc:4555]
Human Orthologues:
GPX3, GPX5, GPX6
Human Descriptions:
glutathione peroxidase 3 (plasma) [Source:HGNC Symbol;Acc:4555]
glutathione peroxidase 5 (epididymal androgen-related protein) [Source:HGNC Symbol;Acc:4557]
glutathione peroxidase 6 (olfactory) [Source:HGNC Symbol;Acc:4558]
Mouse Orthologues:
Gpx3, Gpx5, Gpx6
Mouse Descriptions:
glutathione peroxidase 3 Gene [Source:MGI Symbol;Acc:MGI:105102]
glutathione peroxidase 5 Gene [Source:MGI Symbol;Acc:MGI:104886]
glutathione peroxidase 6 Gene [Source:MGI Symbol;Acc:MGI:1922762]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa1478 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1478
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063625 Nonsense 63 151 3 4
Genomic Location (Zv9):
Chromosome 14 (position 51706292)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50459060
GRCz11 14 49446817
KASP Assay ID:
554-1403.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGGTATGTCCGTCCAGGAAATGGATTCGTTCCTAATTTCCAGYTATTT[G/T]AGAAGGGAGAYGTGAATGGAGACGGAGAGCAGGCCCTTTTCACATTCCTA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461