Busch Lab

ZMP

ank2

Ensembl ID:
ENSDARG00000043313
ZFIN ID:
ZDB-GENE-041010-165
Description:
ankyrin 2, neuronal [Source:RefSeq peptide;Acc:NP_001006063]
Human Orthologue:
ANK2
Human Description:
ankyrin 2, neuronal [Source:HGNC Symbol;Acc:493]
Mouse Orthologue:
Ank2
Mouse Description:
ankyrin 2, brain Gene [Source:MGI Symbol;Acc:MGI:88025]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5447
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043984 None None 312 None 7
ENSDART00000138803 None None 98 None 2
ENSDART00000142580 None None 237 None 6
ENSDART00000145925 None None 467 None 5
ENSDART00000147287 Nonsense 507 3538 14 47
Genomic Location (Zv9):
Chromosome 7 (position 59212419)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57665028
GRCz11 7 57967468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCAGACTCCTCTTCACATTGCATCTCGTCTGGGTAAGACAGAGATTGTC[C/T]AGCTTCTGCTTCAACACATGGCTCATCCAGACGCAGCAACYGCTAATGGT
Long Flanking Sequence:
TGTAACAATACTGCAGGGATACAGCATACAGCATTACAGTTTCACAACTAGTGGGAAACTGATGTAAGCTTTTAAGGAGCTAAAAGAGCAGAATGCCTAAAGGTGACAAGATGTGGCTAATATTTTGTATTAGACAACACGACAACAAATGACAAAATACATAACTGTTAACATTTTAGTACAAAGATTTACTCAAGTTTCCCCTATGCTTATTTAAAACACCAAAAAGTAATGTCCATAATCTGAAGGGTTCGTATGCAAAAAAAAGGCTGCCTAAAAAATTTATTCTAAAATGAGTGTTTTTCTCCTATGTTTATGTTCAGTTATCTCACTTCAATGGCTTAGAGAAGAAAATATTCTTGCTAATTGCTAATTTTAGAAAAAAAGATTTAATGGCACTTTGGATTTTGCAACTGATTATTTTCTGAACTCTCCTCCCTCATCAGGAGGATCAGACTCCTCTTCACATTGCATCTCGTCTGGGTAAGACAGAGATTGTC[C/T]AGCTTCTGCTTCAACACATGGCTCATCCAGACGCAGCAACCGCTAATGGTTACACCCCGCTTCACATTGCTGCACGTGAGGGACATTTGGACGTTACTACTGTGCTATTAGAAGCTGGAGCTGCTCACTCCTTAGCTACCAAGGTCAGTAAAAGTAAGATTTTCACCCATAAAAACGAGAGATTTCAAACTAATTGAAACATTTATGCTTCTTTGAGGTTTAGCTAAACAAAAAAAAGTATATTCTGTTATTCTTTACTCACCCTCGTGTAGTTTGTTTTGGTGCATTAAAATATCAACATTGCTTGTCAGAATTACTTTAGAGCACATTTAAAGGGATACTCACCCTCAAGTGGTTCGAAACCTTTATGAGTGTATTTCTTCTGTTAAACACAAAATAAGATATTTTTAAGCTCAAAACCTGTAATCACGGACTTCCAGGTTTTCGGCATTTTTCAAAATATCTTCTTCTGTTTTTTAACAGAAGATAGAAACTCATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3624
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043984 None None 312 None 7
ENSDART00000138803 None None 98 None 2
ENSDART00000142580 None None 237 None 6
ENSDART00000145925 None None 467 None 5
ENSDART00000147287 Essential Splice Site 754 3538 20 47
Genomic Location (Zv9):
Chromosome 7 (position 59206499)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57659108
GRCz11 7 57961548
KASP Assay ID:
2259-9617.1 (used for ordering genotyping assays)
KASP Sequence:
TAGAAACATGTTATATGCACTTTGGAAAATATAATATTTTTGTCTTTGTC[A/T]GAATGGTTATACACCTTTGCACCAGGCTGCACAACAAGGCAACACACACA
Long Flanking Sequence:
TGTATATGGGTATATATGAAAAAATGATTCTGGGTTGGTTAATTTATGTAATTCATGTTTTCTTAGAGTGGACTTACATCCCTTCACCTTGCTGCCCAAGAAGATAAAGTAGGTGTTGGTGAGATCTTAGTGAAGCAAGGTGCCAACTTAGACCAACAAACCAAAGTAAGCAGATTTTATCATACACCAAAAAATTTTTTGTTAATCAATTTTACTGACCATGGCCCTATAATATTCTTTCCAGTTGGGATACACACCTCTTATTGTGGCCTGTCACTATGGAAATGCTAAGATGGTTAATTTTCTGTTGAAGAGTGGGGCAAGTGTCAACGATAAAACAAAGGTATTTCTCAGTGTGTCCATTATTTGTATTATTATGTATACAACTTTACATAAACACTTCAATATAATCCTAAGTTTTATATACAAAAGTAATAATTACACAAAAGGTAGAAACATGTTATATGCACTTTGGAAAATATAATATTTTTGTCTTTGTC[A/T]GAATGGTTATACACCTTTGCACCAGGCTGCACAACAAGGCAACACACACATCATTAATGTCTTACTCCAGTATGGGGCCAAACCCAATGCCATCACTGTGGTGAGTAAATATAAACACACACACACACACAGCAATTTATATTCTTGCAGATGCTTTATTAAAATCTACAAAACATCAACATTGTTTTAAATACAAATTCACCTGAAAAATAAATAGGTAACACTTTACAATAAGGGTGTATTAGTAATGCTAGTTACCGTTTGTGAAATATGAATTAACAGTGAATAAAACATATGTTAATCATTGTTTGATCTTTGTTATTGTTAACTAAACCTTTATTGATGTGTTATTTAATAGATTAGTCAACATTAATTAGTGGTATAACAACTACTATTATATTACTAATAATACATAATCTTTGTTCATGTTAACTTATTCTTATCACCTTTACATTTTTTGGTCCCACTTTATATTAAGTGCCCGTAACTACTATGTACTC
Associated Phenotype:
Not determined