Busch Lab

ZMP

obscn

Ensembl ID:
ENSDARG00000043309
ZFIN ID:
ZDB-GENE-040812-4
Description:
Obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF [Source:UniProtKB/TrEMBL;Acc:B8JI51]
Human Orthologues:
MYOT, MYPN, PALLD
Human Descriptions:
myopalladin [Source:HGNC Symbol;Acc:23246]
myotilin [Source:HGNC Symbol;Acc:12399]
palladin, cytoskeletal associated protein [Source:HGNC Symbol;Acc:17068]
Mouse Orthologues:
Myot, Mypn, Palld
Mouse Descriptions:
myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]
myotilin Gene [Source:MGI Symbol;Acc:MGI:1889800]
palladin, cytoskeletal associated protein Gene [Source:MGI Symbol;Acc:MGI:1919583]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa21250 Nonsense Available for shipment Available now
sa12899 Nonsense Available for shipment Available now
sa1115 Nonsense Available for shipment Available now
sa17011 Nonsense Available for shipment Available now
sa12781 Nonsense Available for shipment Available now
sa1045 Nonsense F2 line generated Not yet available
sa41172 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21250
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Nonsense 223 1992 5 34
Genomic Location (Zv9):
Chromosome 8 (position 18915602)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18360490
GRCz11 8 18396202
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCGCCATGTCTTTCTCTTCAAAGACTGCATAGTCTTCTGCAAGCCAAAA[A/T]GAGAAGTTGGCACACACACCGAGGCCTACATATTCAAGAATAAAATGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12899
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Nonsense 259 1992 6 34
Genomic Location (Zv9):
Chromosome 8 (position 18914862)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18359750
GRCz11 8 18395462
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGATGTAAAGGACACAGCAGAAGGAGATGACAGRTCATTTGGGCTTTG[G/A]CACGAGCAWCGGGGAATGGTGAGAAAAATCATTTTGYAAGCTCGTTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1115
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Nonsense 272 1992 6 34
Genomic Location (Zv9):
Chromosome 8 (position 18914825)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18359713
GRCz11 8 18395425
KASP Assay ID:
554-1017.1 (used for ordering genotyping assays)
KASP Sequence:
CATTTGGGCTTTGGCACGAGCATCGGGGAATGGTGAGAAAAATCATTTTG[C/T]AAGCTCGTTCCATCCTCCTTCGTCTSTCCTGGCTCAAAGACCTGAGAGAC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa17011
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Nonsense 410 1992 9 34
Genomic Location (Zv9):
Chromosome 8 (position 18912107)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18356995
GRCz11 8 18392707
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCCTCCRAGTTTCAMAACCAGACTGCAGAACGCAGTGCTTGTAAAAGGA[C/T]AAGATGTGCAGTTCAWGTGTTCCACACAATCTGTTCCTTTCCCATCAAYA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa14845
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Nonsense 863 1992 21 34
Genomic Location (Zv9):
Chromosome 8 (position 18900702)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18345590
GRCz11 8 18381302
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATKCTGTCATACTTTTTTTTTNGGTTAAWGTTATTTTTTATTTATTCCAG[G/A]TCTCTTGGTGTGGTTGCTTACTTATGGTGAGTGCTTTGAMATTTACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12781
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Nonsense 1602 1992 27 34
Genomic Location (Zv9):
Chromosome 8 (position 18894918)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18339806
GRCz11 8 18375518
KASP Assay ID:
2260-0393.1 (used for ordering genotyping assays)
KASP Sequence:
TTYTGGAAACCTGTGCCATCCAAAGAGCTTGTCACATATTGTATTCAGTA[T/A]AGTGTAAATGGTAAGAATAYATACTAAAGSAATACACTCAGTYCCAWCTR
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8312
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Essential Splice Site 1662 1992 28 34
Genomic Location (Zv9):
Chromosome 8 (position 18894626)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18339514
GRCz11 8 18375226
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTTTCAGTGATCCATCACCACCTGCCTTCATGGCAATACCTTATGAAGG[T/C]ATGCTAATTAAAATAAAAATAAMACTGAAGTTAAATAGTTTATTTACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1045
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Nonsense 1750 1992 30 34
Genomic Location (Zv9):
Chromosome 8 (position 18892538)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18337426
GRCz11 8 18373138
KASP Assay ID:
554-0948.1 (used for ordering genotyping assays)
KASP Sequence:
ATATCAAGTGCTCCGTCGACTCRGCCACCCTCGAATCGTCCAGCTGCATT[C/A]GGCCATCCTCACCTCCACCTGCCTGCTGCTTATAGAGGAGCTGTGCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41172
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Essential Splice Site 1852 1992 31 34
Genomic Location (Zv9):
Chromosome 8 (position 18892144)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18337032
GRCz11 8 18372744
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACAGGCGCTGAACATTGAACATATCAGGGAAATGACAGATAATAAAGG[T/A]AAATCAAAGATACTGTAGTATGATCTAAAAACTATTGCTTTTGATTTTAC
Associated Phenotype:
Not determined