Busch Lab

ZMP

si:dkey-91i17.1

Ensembl ID:
ENSDARG00000043304
ZFIN ID:
ZDB-GENE-050309-7
Description:
Si:dkey-91i17.1 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZR4]
Human Orthologue:
NOP2
Human Description:
NOP2 nucleolar protein homolog (yeast) [Source:HGNC Symbol;Acc:7867]
Mouse Orthologue:
Nop2
Mouse Description:
NOP2 nucleolar protein homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:107891]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa36089 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16537 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28627
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063573 Essential Splice Site 348 658 10 18
ENSDART00000114272 Essential Splice Site 353 739 9 16
ENSDART00000130222 Essential Splice Site 353 739 8 15

The following transcripts of ENSDARG00000043304 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 19302797)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17333120
GRCz11 16 17241097
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAATGGTCAAAAGTGGGGCTGGTTATCTATGACTCCTCTGTTCCCATAG[G/A]TCAGTTTCAAAATAAGATTTTTTCATTGTTCTTTATTTCTGGTGACCGTA
Long Flanking Sequence:
TAAATCCAGAAAGATTCCTATATTCCTTGGCTAAAATTGTTTAAATAGCCAATTAATGGCCATTGCGATCAAATTCTTCCTCTTTTGGAATTCTTGAAGTGTCTGAAGATATCCGAAAATTTCCTGCTGTCTGACCTATGACTATTGTCAAACTACGAACTAATTGACGTGGTTAAACTGAAGATACAATCAATATGACTAATTCTGGGAAACAATATTGTTTTGTTTTTTTAAACAATGTTTAAATGTTGCTACAAGATAGACACTTAACAAGTGTCTTGTTTTACAAGTTTTCAAAACGTTACACCTGTAACAGATATTATTACTGTGCAAAAATGGTCAAAGTGGTTATACAGATGTCAGTCTGGTTCACAGATATCTTGTGTAATCTAATGGTTCATTCATACCATAGGCTCTGATTAACAGAGGAGTAAACCTGGATCCATTGGGGAAATGGTCAAAAGTGGGGCTGGTTATCTATGACTCCTCTGTTCCCATAG[G/A]TCAGTTTCAAAATAAGATTTTTTCATTGTTCTTTATTTCTGGTGACCGTAAGCTCAAATGTCAATAATAATCGTTTGTTTTTTATACAGGAGCAACTCCTGAATATTTGGCAGGCCATTACATGTTACAAGGCGCATCTTCTTTTTTGCCTGTAATGGCTCTGTCTCCCCAGGAGGGGGAGTCCGTGTTGGATATGAGCGCCGCTCCTGGAGGCAAGACCACTTATATGGGTGAGCATATGCTTCTCTACGGCAGTCAGACCAACTGCTGTGTTTTTGTAAAGTGGCTAATCTCTTTTTTATTAGCACAGCTGACACACGAGAATAAAAGCAATGTGAAAACATGCACTATTATCTTTCTACAATAACAATTGAAGTGTCAGAATAGGTTTTTAGAGTTTGTGTATAATATGTCTGGTGCAGCTCAGCTCATGAGGAATACTGGCATGATCGTGGCTAATGACGCAAATGTAGACAGACTGAAGAGTGTGGTGGGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36089
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063573 Essential Splice Site 546 658 16 18
ENSDART00000114272 Essential Splice Site 551 739 15 16
ENSDART00000130222 Essential Splice Site 551 739 14 15

The following transcripts of ENSDARG00000043304 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 19297241)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17327564
GRCz11 16 17235541
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCAGAGAAATTATAAAGTGCATTTTGAAAATCTTGATCTCTTCTCTGTA[G/A]ATTCAAAGAGAAACGTTTCCATCCTTCTCTTAAACTGTCTCGACGATTCT
Long Flanking Sequence:
CACTTCATGGCCTCAAAGTTTTACAGTCTAAAAATTGTATACAAATCTTAGTTTCAAAACAATAAAGAAGCAACCTGTGAACTAAATCTGAGTTGATGGTGAAAGCCTTTTAAGTTTCTGTCTGATTATGGACTAAAGCAGATATTGCAACATTTTAGAGGAAAAGTGAAACAGGTAGATGTAAAATGTATTAATCTATATTTTAAAAGCTAAAGTATGTCTGCTGAAATATGCCAATTTTCTGTCCATTTGGTATGAGATTTGATTTGTCTCTATAGGTGGAAGAGAATGAGTGGGTGGTAGATTATGCTTTGAAGAAGAGAAATGTTAAGCTTGTCCCCACTGGATTGGACTTTGGCAAAGAGGGATTTACCAGGTAATGAGATCTTATTTGAAATTCATCAACAGTAATAAAGGTTATAGTCCTAGAAATTAAGTTCAAGTGTGTTTGCCAGAGAAATTATAAAGTGCATTTTGAAAATCTTGATCTCTTCTCTGTA[G/A]ATTCAAAGAGAAACGTTTCCATCCTTCTCTTAAACTGTCTCGACGATTCTACCCTCACTCTCACAACATGGATGGGTTTTTTGTGGCCAAGCTAAAGAAGCTGTCTAACACCATCCCTACTGCTCCAAAAGAAACAGGTGTGTGCTTATTTCAAAAGATTTTATCCACAAATTTGTATTGTATTTTATTTAAAATTTTTAAACATATTCCTTAGAAAATCAAGAAGAATCACTTGTAATGGAGACTGCAGCTTCATCAGAGATGAAAGAACAGAAGCCTGCTTCAACTCCAGAAAAAAGCAGCTTTGAAAAGAAACAGAAATTGAATCCTCAAACATCCAAGCCACTCATCGTTAAAAAGAAAGCTGAGAATAAAAAAACTGGCCCCAAAAAAGCCAAAATTGCCAAGCTGGATAGTGAAGCTGCAAAAAAGTTTGAGAAACCTAGCAAAAAACAGAAGGGAAAGCAAATGAATGGCAATCCAACAACAGAGGGGATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16537
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063573 Essential Splice Site 651 658 None 18
ENSDART00000114272 Missense 657 739 16 16
ENSDART00000130222 Missense 657 739 15 15

The following transcripts of ENSDARG00000043304 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 19296846)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17327169
GRCz11 16 17235146
KASP Assay ID:
2260-9473.1 (used for ordering genotyping assays)
KASP Sequence:
ACTCATCGTTAAAAAGAAAGCWGAGAATAAAAAAACTGGCCCCAAAAAAG[C/A]CAAAATTGCCAAGCTGGATAGTGAAGCTGCAAAAAAGTTTGAGAAACCTA
Long Flanking Sequence:
AATTCATCAACAGTAATAAAGGTTATAGTCCTAGAAATTAAGTTCAAGTGTGTTTGCCAGAGAAATTATAAAGTGCATTTTGAAAATCTTGATCTCTTCTCTGTAGATTCAAAGAGAAACGTTTCCATCCTTCTCTTAAACTGTCTCGACGATTCTACCCTCACTCTCACAACATGGATGGGTTTTTTGTGGCCAAGCTAAAGAAGCTGTCTAACACCATCCCTACTGCTCCAAAAGAAACAGGTGTGTGCTTATTTCAAAAGATTTTATCCACAAATTTGTATTGTATTTTATTTAAAATTTTTAAACATATTCCTTAGAAAATCAAGAAGAATCACTTGTAATGGAGACTGCAGCTTCATCAGAGATGAAAGAACAGAAGCCTGCTTCAACTCCAGAAAAAAGCAGCTTTGAAAAGAAACAGAAATTGAATCCTCAAACATCCAAGCCACTCATCGTTAAAAAGAAAGCTGAGAATAAAAAAACTGGCCCCAAAAAAG[C/A]CAAAATTGCCAAGCTGGATAGTGAAGCTGCAAAAAAGTTTGAGAAACCTAGCAAAAAACAGAAGGGAAAGCAAATGAATGGCAATCCAACAACAGAGGGGATAAAGGAGAAGAAAGAGGGCAGTCCATTCAAGAAGAAAGAAAACAAAACCAAAAAGAAGAACCTGCTGAAGAAAAAGAAGAACAGAATGGGGAAAAACAAATTTAAGAAGTTAAAAAGTATGCTTGGACAGCAAGAAAGTGGCCAGTGAACTTTAGTCATCTGACAGTAAATTGACATGGACCTATATGCTCAGGACTGGGATCTGTCAGTGGTTTGACCCAAGACAGTAAGTTAAACCAGTCCCAGCTTGCTGTTGGGGACTCAAAGATCATTCTTTAGTAACTTACACAGTGAATTTGTGTATTTATACTGCTTTTCAAGACTGTCAACCTTACTGATTCACCAAGAAGGTTACTTCAACCTTCTTGTGATATAAATGTCATAAATGTAAATGTCAT
Associated Phenotype:
Not determined