Busch Lab

ZMP

si:ch211-103a14.5

Ensembl ID:
ENSDARG00000043294
ZFIN ID:
ZDB-GENE-091204-414
Human Orthologue:
GUCA1A
Human Description:
guanylate cyclase activator 1A (retina) [Source:HGNC Symbol;Acc:4678]
Mouse Orthologue:
Guca1a
Mouse Description:
guanylate cyclase activator 1a (retina) Gene [Source:MGI Symbol;Acc:MGI:102770]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa3155 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3203
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063554 Essential Splice Site 66 201 1 5
ENSDART00000146591 Essential Splice Site 73 199 1 4
Genomic Location (Zv9):
Chromosome 22 (position 2308469)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1121317
GRCz11 22 1138215
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATCSAACGAATACGTCATGACCATGTTCCAGACGTTCGATATGAATGAC[G/T]TAAGATATTCTRTTTACCTTTTTAAAAAGTGGAGTCATGCTTTAGAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3155
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063554 Nonsense 164 201 4 5
ENSDART00000146591 Nonsense 170 199 4 4
Genomic Location (Zv9):
Chromosome 22 (position 2317076)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1129924
GRCz11 22 1146822
KASP Assay ID:
554-2548.1 (used for ordering genotyping assays)
KASP Sequence:
GGAGTGTTGACTATGGATGAGTTTATGGAGGGCATTCAGGCAGACGAGTA[T/A]CTCTCCACCATGCTGACTCAGAGTCTGGATCTCACACACATCGTCAAAAA
Associated Phenotype:
Not determined