Busch Lab

ZMP

nfic

Ensembl ID:
ENSDARG00000043210
ZFIN ID:
ZDB-GENE-080305-2
Description:
Nuclear factor 1 [Source:UniProtKB/TrEMBL;Acc:B0S4Z1]
Human Orthologue:
NFIC
Human Description:
nuclear factor I/C (CCAAT-binding transcription factor) [Source:HGNC Symbol;Acc:7786]
Mouse Orthologue:
Nfic
Mouse Description:
nuclear factor I/C Gene [Source:MGI Symbol;Acc:MGI:109591]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa21264 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21264
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088668 Nonsense 156 506 2 11
ENSDART00000135850 None None 145 None 3
ENSDART00000138604 Nonsense 156 499 2 10
Genomic Location (Zv9):
Chromosome 8 (position 21218239)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20648136
GRCz11 8 20680221
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGCATCCCGCTCGAGAGCACAGACGGGGAGCGACTGGTTAAAGGTGGC[C/T]AGTGCTCCAATCCCATCCTCTGCGTCCAGCCTCATCACATCAGCGTGTCC
Associated Phenotype:
Not determined