Busch Lab

ZMP

si:dkey-220o5.3

Ensembl ID:
ENSDARG00000043179
ZFIN ID:
ZDB-GENE-030131-5484
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JJ17]
Human Orthologue:
BAG4
Human Description:
BCL2-associated athanogene 4 [Source:HGNC Symbol;Acc:940]
Mouse Orthologue:
Bag4
Mouse Description:
BCL2-associated athanogene 4 Gene [Source:MGI Symbol;Acc:MGI:1914634]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa21369 Nonsense Available for shipment Available now
sa10354 Nonsense Available for shipment Available now
sa45335 Nonsense Mutation detected in F1 DNA Not yet available
sa11414 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21369
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063396 Nonsense 124 399 3 5
Genomic Location (Zv9):
Chromosome 8 (position 46936456)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44610627
GRCz11 8 44604533
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTACATCCTTCTAATCCATTCTACTGCAGTGACCAGGTTCCTTCAAGA[C/T]AACCTCATTATCACAACCAATCCTGCCCTGAACAGAATGCAGGGGGCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10354
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063396 Nonsense 145 399 3 5
Genomic Location (Zv9):
Chromosome 8 (position 46936521)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44610562
GRCz11 8 44604468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACCAATCCTGCCCTGAACAGAATGCAGGGGGCTCGACTCATCCCCCCTA[C/A]CCTGTACCTCACTGCCAAGCGGTAAATTCAGCTACATATAAGGATAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45335
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063396 Nonsense 185 399 4 5
Genomic Location (Zv9):
Chromosome 8 (position 46938720)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44608363
GRCz11 8 44602269
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCTCAGAATGCACCTTACCCCAACCAGCAGCCTGTGCTGTCAAGACCC[C/T]AGCATGAGGCTTGGTCCCACACTCAAGGGTATGGACCCACACTGCCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11414
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063396 Nonsense 215 399 4 5
Genomic Location (Zv9):
Chromosome 8 (position 46938812)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44608271
GRCz11 8 44602177
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCCTCAGCAGCAATGGCCTTCTGATTCCCAGACACCCCATAGCCACTA[T/A]GGCAGTCATGTACGACCACCTCACCCCCCTCCATGGCAAGGACCYRCACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa446
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063396 Nonsense 301 399 5 5
Genomic Location (Zv9):
Chromosome 8 (position 46940833)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44606250
GRCz11 8 44600156
KASP Assay ID:
554-0299.1 (used for ordering genotyping assays)
KASP Sequence:
AGACTTCCTCTGGCGTTGGAGGACTCGAACCCAAACCTGCCCAAAATGAA[C/T]AACCTCCTATGTCTTCCCCTCCAGCGTCGTCCATGCCAGCTCCACTAAAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461