Busch Lab

ZMP

dnajb13

Ensembl ID:
ENSDARG00000043157
ZFIN ID:
ZDB-GENE-040910-4
Description:
dnaJ homolog subfamily B member 13 [Source:RefSeq peptide;Acc:NP_001017606]
Human Orthologue:
DNAJB13
Human Description:
DnaJ (Hsp40) homolog, subfamily B, member 13 [Source:HGNC Symbol;Acc:30718]
Mouse Orthologue:
Dnajb13
Mouse Description:
DnaJ (Hsp40) related, subfamily B, member 13 Gene [Source:MGI Symbol;Acc:MGI:1916637]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18993 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18993
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063365 Essential Splice Site 112 322 None 8
ENSDART00000148093 Essential Splice Site 112 322 None 8

The following transcripts of ENSDARG00000043157 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37924738)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36736899
GRCz11 10 36680657
KASP Assay ID:
2261-7166.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGATGAAACATTTCGACAGTTTTTCGGAGGAGATAATCCTTTTGCAGG[T/C]TATTTTTTAAGGGATGAAAACACTCTCAAATGACTGATCATCTACGTCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27653
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063365 Nonsense 200 322 5 8
ENSDART00000148093 Nonsense 200 322 5 8

The following transcripts of ENSDARG00000043157 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37923638)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36735799
GRCz11 10 36679557
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTAAAAGCAGGATGGAACGAAGGGACACGGATCACGTTTCCTAAAGAG[G/T]GAGATCAGGCATGGCTAAACACATGATCACTGTTTTATCGGGCTATGTTT
Associated Phenotype:
Not determined