Busch Lab

ZMP

alox5

Ensembl ID:
ENSDARG00000043085
Human Orthologue:
ALOX5
Human Description:
arachidonate 5-lipoxygenase [Source:HGNC Symbol;Acc:435]
Mouse Orthologue:
Alox5
Mouse Description:
arachidonate 5-lipoxygenase Gene [Source:MGI Symbol;Acc:MGI:87999]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa39020 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39020
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063257 Essential Splice Site 397 676 9 14
Genomic Location (Zv9):
Chromosome 15 (position 943398)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 983701
GRCz11 15 944504
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGTTTGAAGCTTGAAGCATGTTTTCTCTGAATACTTTTTCTCTTCTCT[A/G]GTTACTGATCCCTCATGTCCGTTTCACCATTGCCATCAACACTGCAGCAC
Long Flanking Sequence:
TTAGCATTTTAAATAGATTTATTATTAAAGTTCAGAGATATAACTTATTTGCCTTAGGACTTTCCCTAAATGGAACGGTGAATATAAACATTATCATGGACATCTTAATAAAGGAATGAACACAATAAGGGTGTTTATTTGCTGAAATTCATATAAAAATCTGTGTTATTTATATCGTGCAACGTATATTTATCTCTGTCTTCGCGGTCTCCTGAATTAGTTCTTCCAAGGACACATGGCAAGACCGGTCTCCACAAGAACGCAAGTCCATTCTCTACGTTCTTGGAATTGAGAAACAGCCTTGTTCTTTGCCTCAGGAGAACGATCTTGCCTTTATCGTTTTATTACATTTTACCTGGGTAAACCACAAACCTTCCCAAACTCAAGAGAATGGATGTAAATGTTTAGAGGATTTCTAATTAATATTAAAGGTGTTTTATAATTCAGTTTATGGTTTGAAGCTTGAAGCATGTTTTCTCTGAATACTTTTTCTCTTCTCT[A/G]GTTACTGATCCCTCATGTCCGTTTCACCATTGCCATCAACACTGCAGCACGTGAAAAACTCATCAATGACACTGGGGTCTTTAATGAGGTATTTATTACCATTTCCTATACTCAAATAAGTTAACAAGCCACTTGCTCGATTTGCAAAATACAAATATGTCTCATTAAAAAGAATGGAACTAGTTTAGTTCTGTTAAACGATGCTTTCATGTTGTTTCTTCTGTTCGTGGACAAAACTTCTTGTGCGCACTAAAAACACCGGCTGCTCACAAATAAACTACTTGAAATACTTAAGTACAAAAAATTTAAACACTTGAGTACTTTCACTTCAGTATGGTGCTTAAAGAGCACTTCATCTTCTACTCAAGTCACTTTTTGACAGAGCACTTGCACTTTTTCCCAAATCTGGATCTCTAGTATCATATAAATGTTTGCTTTTAAATAACAGTAACAAGTAATCTGTAATGTATTACAGTTTGGAAATAACTTGCACAACACTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28383
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063257 Nonsense 662 676 14 14
Genomic Location (Zv9):
Chromosome 15 (position 941562)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 981865
GRCz11 15 942668
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCATCACTAAGATCATCAGAAAGAGAAATGAAACTCTGGAGCTGCCCTA[C/A]TTGTATCTGTGTCCAGACAGGATCCCCAACAGCGTGGCCATCTGAAGAAA
Long Flanking Sequence:
GTGGGATTTCACACACTTTTCTGGAGGAATATAAACAAGACCTTGTAAATATCCAGCCTGATATCTGTGTGTCTCTCCTGTGTTCCAGTTTGACTGGTTTGCTTGGGTCCCGAACACTCCGTCCACCATGCGGAAACCTCCACCCACAGAGAAGGGCAAAGTGGATATGAAGTACATCATGGAGAGTCTGCCGGACCGCCAACGCTCCAGTTGGCATATAGGAGCAGTTTGGGCCCTCAGTCAGTTCCAGGACAGTGAGGTTTGATTACTGAATTTTCATAACTAGCTTACAGTAGACCTGCTTTCATTATACTTATTGACCAAACAAAACAACAATTCACTGTTTTGTCCTAATCTTCTGTCCAGCTGTTTTTAGGCGAATACCCTGATAAGTATTTCACTGAAAAACTGGTCACTGAAGCAATTGAGAATTTCCGCAAGGAATTATTTGTCATCACTAAGATCATCAGAAAGAGAAATGAAACTCTGGAGCTGCCCTA[C/A]TTGTATCTGTGTCCAGACAGGATCCCCAACAGCGTGGCCATCTGAAGAAAACATCTGTGGCGAACATCTTCAAAAGCTGCTCACAGTTCATTTACACAGTATTTGCTTAGCACTTTAAAAAAAAGGCAGCAAAAAACATTGGAAAGCATGGTTTTAATTGGGCTGTTTAGATCTGTATCACACACAAAAAAATAAGCACAACAAATTACTGTAATACAGCGGTCCTAAACTCAATTCCTGGAGGGCCGCAGCTCTGCGTACTTTAGCTCCAACCACCTTCAACTCACACCTGTGTAATAGTAGTCTTGAACACCTAGTAGTCTTGAACATTTAACTATTGAACTATTTAGAACATTAACATAATGGATACAGCAGTGGATATAAACGAGTACCCTGTCACATTTGCCATGCCAAAACTGCAATGCTAAACGCGCGTGCGTGTGTGTGTGCGCTCAAACTCCACACCAAATACATCAAACAACCGTTGAAAAAGTTTGTAC
Associated Phenotype:
Not determined