Busch Lab

ZMP

fbxl5

Ensembl ID:
ENSDARG00000043046
ZFIN IDs:
ZDB-GENE-030131-900, ZDB-GENE-030131-900
Description:
F-box/LRR-repeat protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q2YDQ5]
Human Orthologue:
FBXL5
Human Description:
F-box and leucine-rich repeat protein 5 [Source:HGNC Symbol;Acc:13602]
Mouse Orthologue:
Fbxl5
Mouse Description:
F-box and leucine-rich repeat protein 5 Gene [Source:MGI Symbol;Acc:MGI:2152883]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa24418 Nonsense Available for shipment Available now
sa44065 Nonsense Mutation detected in F1 DNA Not yet available
sa7510 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4247
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102891 Nonsense 1 694 1 12
ENSDART00000123100 None None 679 None 11
Genomic Location (Zv9):
Chromosome 23 (position 46157677)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46024210
GRCz11 23 45869001
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTGTGCAGATGTTCAGCGTCRGCAGAGGRTTTTGAGCTGGAGGATCTG[G/A]CGCCCGCGTGTTCAGTCCGCGGCAGTGGAGCTGATGGAGGCGCRATGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24418
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102891 Nonsense 16 694 1 12
ENSDART00000123100 None 1 679 1 11
Genomic Location (Zv9):
Chromosome 23 (position 46157634)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46024253
GRCz11 23 45869044
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATCTGGCGCCCGCGTGTTCAGTCCGCGGCAGTGGAGCTGATGGAGGCG[C/T]GATGGCTCCTTTTCCCGATGAGGTGGATGTTTTCACGGGCCCTCACTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44065
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102891 Nonsense 31 694 2 12
ENSDART00000123100 Nonsense 16 679 1 11
Genomic Location (Zv9):
Chromosome 23 (position 46157586)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46024301
GRCz11 23 45869092
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCGATGGCTCCTTTTCCCGATGAGGTGGATGTTTTCACGGGCCCTCACT[G/A]GCGCATGAAGCAGCTGGTGGGTCTTTACAGCGAAAAGGTTCGTCTATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7510
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102891 Missense 32 694 2 12
ENSDART00000123100 Missense 17 679 1 11
Genomic Location (Zv9):
Chromosome 23 (position 46157584)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46024303
GRCz11 23 45869094
KASP Assay ID:
554-4192.1 (used for ordering genotyping assays)
KASP Sequence:
CRATGGCTCCTTTTCCCGATGAGGTGGATGTTTTCACGGGCCCTCACTGG[C/T]GCATGAAGCAGCTGGTGGGTCTTTACAGCGAAAAGGTTCGTCTWTTACCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5066
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102891 Nonsense 222 694 6 12
ENSDART00000123100 Nonsense 207 679 5 11
Genomic Location (Zv9):
Chromosome 23 (position 46152364)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46029523
GRCz11 23 45874314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTGTGTGTGTNNNNNNNNNNCCTCAGAGCGTGTGTTGGAGCGTGTGT[C/A]GGTGTCGTCTCTCCCRCAGGAGCTGCTTCTGCGTATCTTCAGGTTTCTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30014
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102891 Nonsense 389 694 9 12
ENSDART00000123100 Nonsense 374 679 8 11
Genomic Location (Zv9):
Chromosome 23 (position 46148730)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46033157
GRCz11 23 45877948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTCCCAATCTGACCCATCTGGACCTCACGCAGACAGACGTCTCAGACT[C/A]GGCCTTCGACAGGTTTGCAGATATTATGATCAACTTTTTGTCAATCATTA
Associated Phenotype:
Not determined