Busch Lab

ZMP

si:dkey-12h9.9

Ensembl ID:
ENSDARG00000043035
ZFIN ID:
ZDB-GENE-041001-149
Description:
Novel protein similar to vertebrate calpain 3, (P94) (CAPN3) [Source:UniProtKB/TrEMBL;Acc:Q5SNR7]
Human Orthologue:
CAPN3
Human Description:
calpain 3, (p94) [Source:HGNC Symbol;Acc:1480]
Mouse Orthologue:
Capn3
Mouse Description:
calpain 3 Gene [Source:MGI Symbol;Acc:MGI:107437]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15564 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15564
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063177 Essential Splice Site 202 533 4 12
ENSDART00000136518 Essential Splice Site 202 719 4 20
Genomic Location (Zv9):
Chromosome 20 (position 26023593)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26094896
GRCz11 20 25993986
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACAGAATAATGAATTTTGGAGTGCTCTCATGGAAAAGGCATATGCAAA[G/A]TAAGTTCATTTATTACAATATTTGGCATCAATAACGCTATACTGTGTCAC
Long Flanking Sequence:
CCCACACACATCCAGAAAACCAATTGCTCCCTCTTTTCATCTTATACTATATGCAATATCATTTGTTTATTAAAAATGTATATATTCAGTATGTGTTGTCATAAAGCATGTGGAAAAACCTTTAATGGCCCATTAACATCTGCAGGAGACTGTTGGCTGTTGGCTGCCATAGCTTGCCTGACCCTGAATGATGTCATCCTGAAGAGGGTTGTTCCTCATGACCAAAGCTTCACTGAAAACTATGCTGGCATTTTCCATTTCCAGGTATATGGGCATCAAAACTGTCATGCATTTCATATTTGACACATGAACCCTACACTTGGATGAATGAAGCACAAGCACAAGCACAATTTTGAATGTTTCTAGTTTTGGCGCTATGGTGAGTGGGTGGATGTGGTTATTGACGATCGACTTCCCACATACAAAAACAAGCTGGTCTTTACCAGGTCTGGACAGAATAATGAATTTTGGAGTGCTCTCATGGAAAAGGCATATGCAAA[G/A]TAAGTTCATTTATTACAATATTTGGCATCAATAACGCTATACTGTGTCACTGTCAACTTATGTTCATTCATGCTCTGAATTAAATATATCACAATTAATCCAAGGTGTTGATGTGTCGGTTTGACTTCCGGTTCCCAGGTTACATGGCTCTTATGAAGCCTTAAAGGGAGGGAACTCATTGGAGGCTATGGAGGACTTCACTGGAGGTGTAACTGAGTTCTATGAGATTACAGAAGCCCCGAAAGAGTTGTACAACATCATGAGGAAGGCTCTGAAGAGAGGATCCCTCATGGGCTGTGCCATAGACGTACGTTTCGCTTCCTTTATTAAAATATAATAGGAATAAAAAAGATATGTTGCTTCTCTGTCAAAAAAGTGCAATGTTTTAAAATTATTATTATTCCACACTTTGTCTTTGATGCTTTCGTGCTTTTAGACAGACTCTCTGTCTGTGCATTACCAATGGACATTTTTCAGTCAGCCTTCCTCTTTGATCCACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4901
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063177 Essential Splice Site 259 533 6 12
ENSDART00000136518 Essential Splice Site 259 719 6 20
Genomic Location (Zv9):
Chromosome 20 (position 26022096)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26093399
GRCz11 20 25992489
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGATGTGAYATTAACGTAACTTGCCATTCTATTTTGCTTCTCCTGAAY[A/T]GACTTTGGTTCCAACTGCTCAAAGGACTAAAACTGCATCTGGACTTGTGC
Long Flanking Sequence:
ATGGAATCAAGTCTTTATGAGTGAGTCATTAAATCCTTCACTTAAAATGTTTGATTGTGAGGAGCAGTGATCCAAATTTAAAACAGAAGTCAATGGGGTACTTATAAGAAGAGACCAAAGTGGAGTAGGGTGTAATCAATCTGAGTCAATGAGGAGTTTGTTGAGGAAGAGACCACATGCGTGCCAAAATAGTCAAGATGACAGTGACCCACTTCAGAACCAATAGATCAAGGTGCATTCCCAATGCCAACCAACAGCAGCAACACTGGAAGAAGTGAAGAGGCAAATCAAAGCAGAGATCATTTGACCATAATGGACCAGAAGACAGGAGTCACTGTGTCTCTGTTGGAGGACCGAATACAATGGACACATTGTGTCTGAAATTACTGAACTGTTATAGAAAATCGCAATCTTAATAAATCTTAATCAAATCTTAATAGAATTCACTGCACTGATGTGATATTAACGTAACTTGCCATTCTATTTTGCTTCTCCTGAAC[A/T]GACTTTGGTTCCAACTGCTCAAAGGACTAAAACTGCATCTGGACTTGTGCGAGGCCATGCATATTCAGTCACTGGAGTTGAGCAGGTATGATTTTCATGTGCTTAAACAAAAGTGCACACACCTAAAACAGAACACTGCAAAAAGATGTAGTCTTAGCAACATTTTTTAATGTTATAACAAAAACCTTGTTCACAGGGTAAACGAAAGGATGGTAAAGACCTAATGATTCGTCTGGTTCGTGTGCGAGACCCCTGGGGTGTTGCCCCCCCTCCTGCCTGTAAATCTAATGACTGGGTTGAACTCGCCAAAACCGAACAAGACAAGCAGAGACTACAGCCTGGAGAGCAAGGGGAGTTCTGGTTAGTATTTTTCACCGCTTCATAAAACCATCAGGCTTCCTGAAACTCACAAGTTTTCATTTAATACCAAACCAATGGTGTCCATCTTTTCTTATAATTTTAATCCCTCCTCAAGGATGTGCTTTGAGGAGTTTCAGAAG
Associated Phenotype:
Not determined