Busch Lab

ZMP

slc26a11

Ensembl ID:
ENSDARG00000043021
ZFIN ID:
ZDB-GENE-030131-5349
Description:
sodium-independent sulfate anion transporter [Source:RefSeq peptide;Acc:NP_956061]
Human Orthologue:
SLC26A11
Human Description:
solute carrier family 26, member 11 [Source:HGNC Symbol;Acc:14471]
Mouse Orthologue:
Slc26a11
Mouse Description:
solute carrier family 26, member 11 Gene [Source:MGI Symbol;Acc:MGI:2444589]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa29736 Nonsense Mutation detected in F1 DNA Not yet available
sa24093 Essential Splice Site Available for shipment Available now
sa43785 Nonsense Mutation detected in F1 DNA Not yet available
sa15196 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa29736
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063157 Nonsense 211 572 6 16
Genomic Location (Zv9):
Chromosome 22 (position 11620327)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11480495
GRCz11 22 11510177
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATATTGACATTTATGAAGAATTCTCTGAGTTCGGCTGAAGACGAGGCTT[C/A]GTTTCTCGTGCGATCTGCACGACAGCTGCTGTGGAGTTTAGCTACTAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24093
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063157 Essential Splice Site 227 572 7 16
Genomic Location (Zv9):
Chromosome 22 (position 11620197)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11480365
GRCz11 22 11510047
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATAAACAATATATATTGTTATTAATGTCTATTTTCTGCTGGTGTCTTCA[G/A]TTCGTAATGCACTGGTGGTCATAGCAGCGGCGGGTGTCGCATATTCGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43785
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063157 Nonsense 297 572 8 16
Genomic Location (Zv9):
Chromosome 22 (position 11619120)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11479288
GRCz11 22 11508970
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGGTGTGAATTTGTCAGGATTTAGGTGGTGGTCTTGCTGTCATTCCTT[T/A]AATGGGTGTTTTAGAGAGCATCGCCATTGCGAAGGCATTTGGTAAGGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15196
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063157 Essential Splice Site 366 572 11 16
Genomic Location (Zv9):
Chromosome 22 (position 11615689)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11475857
GRCz11 22 11505539
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTAATTCTCAGACTGGAGTGTGTTCTCCTGCTGGAGGMATCATCACAA[G/A]TAAAACTCACACTTTATRATGGYGTTGATGTTGATRAGGATGCAGAWGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29735
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063157 Nonsense 411 572 12 16
Genomic Location (Zv9):
Chromosome 22 (position 11615476)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11475644
GRCz11 22 11505326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTGCTGTGAGCCCAATGGTGGATTTCAGAGTGCCGCTGCACATCTGG[A/T]GAGTCAAGAGTGAGAATTTAACATCATGTTCACATGAAATTGCATATACA
Associated Phenotype:
Not determined