Busch Lab

ZMP

camk2d1

Ensembl ID:
ENSDARG00000043010
ZFIN ID:
ZDB-GENE-040801-121
Description:
Calcium/calmodulin-dependent protein kinase type II delta 1 chain [Source:UniProtKB/Swiss-Prot;Acc:Q
Human Orthologue:
CAMK2D
Human Description:
calcium/calmodulin-dependent protein kinase II delta [Source:HGNC Symbol;Acc:1462]
Mouse Orthologue:
Camk2d
Mouse Description:
calcium/calmodulin-dependent protein kinase II, delta Gene [Source:MGI Symbol;Acc:MGI:1341265]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa25374 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41051 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25374
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056466 Essential Splice Site 73 491 3 19
ENSDART00000136175 None None 289 None 10
ENSDART00000138757 None None 245 None 5
ENSDART00000142259 Essential Splice Site 73 476 3 18
ENSDART00000148369 None None 264 None 11

The following transcripts of ENSDARG00000043010 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 59030856)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57483465
GRCz11 7 57785905
KASP Assay ID:
554-7310.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGAACGAGAGGCCAGAATTTGTCGTCTACTCAAGCATGCTAATATTGG[T/A]GAGTGCAACCACACACACACAAACACGCGCAAACACGCACACATGCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41051
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056466 Essential Splice Site 314 491 12 19
ENSDART00000136175 Essential Splice Site 112 289 4 10
ENSDART00000138757 None None 245 None 5
ENSDART00000142259 Essential Splice Site 314 476 12 18
ENSDART00000148369 Essential Splice Site 236 264 9 11

The following transcripts of ENSDARG00000043010 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 59092896)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57545505
GRCz11 7 57847945
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTAGGGTGCTATTCTTACTACCATGCTTGCCACACGGAACTTCTCAA[G/A]TAAGAAACTATTGTATTCTGTATGTAATAATTGTTCCTTCTTTTAATTAA
Associated Phenotype:
Not determined