Busch Lab

ZMP

gnav1

Ensembl ID:
ENSDARG00000043006
ZFIN ID:
ZDB-GENE-081031-92
Description:
Guanine nucleotide binding protein alpha subunit v1 subtypeNovel protein similar to vertebrate guani
Human Orthologues:
GNA11, GNA14, GNA15, GNAQ
Human Descriptions:
guanine nucleotide binding protein (G protein), alpha 11 (Gq class) [Source:HGNC Symbol;Acc:4379]
guanine nucleotide binding protein (G protein), alpha 14 [Source:HGNC Symbol;Acc:4382]
guanine nucleotide binding protein (G protein), alpha 15 (Gq class) [Source:HGNC Symbol;Acc:4383]
guanine nucleotide binding protein (G protein), q polypeptide [Source:HGNC Symbol;Acc:4390]
Mouse Orthologues:
Gna11, Gna14, Gna15, Gnaq
Mouse Descriptions:
guanine nucleotide binding protein, alpha 11 Gene [Source:MGI Symbol;Acc:MGI:95766]
guanine nucleotide binding protein, alpha 14 Gene [Source:MGI Symbol;Acc:MGI:95769]
guanine nucleotide binding protein, alpha 15 Gene [Source:MGI Symbol;Acc:MGI:95770]
guanine nucleotide binding protein, alpha q polypeptide Gene [Source:MGI Symbol;Acc:MGI:95776]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa14474 Essential Splice Site Available for shipment Available now
sa39362 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24095 Nonsense Available for shipment Available now
sa39361 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14474
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063143 Essential Splice Site 106 362 3 9
ENSDART00000137537 Essential Splice Site 107 363 3 9
Genomic Location (Zv9):
Chromosome 22 (position 11690148)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11550316
GRCz11 22 11579998
KASP Assay ID:
2261-6500.1 (used for ordering genotyping assays)
KASP Sequence:
GCATGGGATGGGTGTCCTTCGCATCAACCTCGCCAACCCAAAAAACAAGG[T/A]CTGTTGCTKTCTTCACTACACTTTACAGACACAATATGTRCTTNTTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39362
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063143 Essential Splice Site 246 362 6 9
ENSDART00000137537 Essential Splice Site 247 363 6 9
Genomic Location (Zv9):
Chromosome 22 (position 11659940)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11520108
GRCz11 22 11549790
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCTCTCTGAGTGGATACGACATGACGCTGGTAGAGGATCCATCTATGG[T/C]GAGGAAACACTTTTGTGTCCATGAAAAAAAGGCCTCAAGAGCCCAAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24095
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063143 Nonsense 260 362 7 9
ENSDART00000137537 Nonsense 261 363 7 9
Genomic Location (Zv9):
Chromosome 22 (position 11657609)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11517777
GRCz11 22 11547459
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGTTCAGAATCGCCTGCAGGAGAGTCTCAAGCTCTTCTCTTCAATCTG[C/A]AACAACATCTTCTTCAGGGGCACCTCCATGGTAAGAGACGAGTCTATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39361
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063143 Nonsense 282 362 8 9
ENSDART00000137537 Nonsense 283 363 8 9
Genomic Location (Zv9):
Chromosome 22 (position 11652392)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11512560
GRCz11 22 11542242
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATTTTTTTTTTGCAGATTTTATTCATGAATAAGATTGATCTTTTCCAA[G/T]AGAAGATCCTCCACTCGGGGCGTCATCTGCGCCATTACCTTCCCCAGTTC
Associated Phenotype:
Not determined