Busch Lab

ZMP

sptlc1

Ensembl ID:
ENSDARG00000042995
ZFIN ID:
ZDB-GENE-050522-61
Description:
serine palmitoyltransferase 1 [Source:RefSeq peptide;Acc:NP_001018307]
Human Orthologue:
SPTLC1
Human Description:
serine palmitoyltransferase, long chain base subunit 1 [Source:HGNC Symbol;Acc:11277]
Mouse Orthologue:
Sptlc1
Mouse Description:
serine palmitoyltransferase, long chain base subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1099431]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34823 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12144 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34823
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063120 Essential Splice Site 117 472 4 15
ENSDART00000133927 Essential Splice Site 129 484 4 15
Genomic Location (Zv9):
Chromosome 10 (position 5243509)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5239803
GRCz11 10 5240107
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTGCCTCGTTTAACTTCTTGGGTCTGCTTGACAATGAGCGCGTGAAGG[T/C]TTGTAGCCGCTTTAAGGGCTTTTCCATTCCTCACATTTACATCCATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12144
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063120 Nonsense 451 472 15 15
ENSDART00000133927 Nonsense 463 484 15 15
Genomic Location (Zv9):
Chromosome 10 (position 5267840)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5264134
GRCz11 10 5264438
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATGTTGAATATTTTGTCCNTCAGCATTCGAGTAGTTGTGACCGTCGAA[C/T]AAACGCARGAGGAAATCGARAAGGCAGCACAGTGYATTCGAGAAGCAGCT
Associated Phenotype:
Not determined