Busch Lab

ZMP

zgc:153443

Ensembl ID:
ENSDARG00000042988
ZFIN ID:
ZDB-GENE-060825-277
Description:
hypothetical protein LOC751686 [Source:RefSeq peptide;Acc:NP_001038865]
Human Orthologue:
SLC24A2
Human Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 [Source:HGNC Symbol;Acc:1097
Mouse Orthologue:
Slc24a2
Mouse Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 Gene [Source:MGI Symbol;Acc:

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa16853 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa16853
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080100 Missense 210 619 2 10
ENSDART00000111805 Essential Splice Site 209 231 None 3

The following transcripts of ENSDARG00000042988 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 11274952)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11328352
GRCz11 1 12015152
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTCATCTCACACAGCAAYGTSGGCATCGGGACCATCGTGGGCTCYGCCG[T/A]CTTCAACATCTTGTTCGTGATCGGGATGTGCGCTCTCTTTTCACGTGAGA
Associated Phenotype:
Not determined