Busch Lab

ZMP

has1

Ensembl ID:
ENSDARG00000042983
ZFIN ID:
ZDB-GENE-040218-2
Description:
hyaluronan synthase 1 [Source:RefSeq peptide;Acc:NP_001157502]
Human Orthologue:
HAS1
Human Description:
hyaluronan synthase 1 [Source:HGNC Symbol;Acc:4818]
Mouse Orthologue:
Has1
Mouse Description:
hyaluronan synthase1 Gene [Source:MGI Symbol;Acc:MGI:106590]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa8945 Nonsense Mutation detected in F1 DNA Not yet available
sa36125 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8945
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063114 Nonsense 105 571 1 4
ENSDART00000130420 Nonsense 151 617 2 5
Genomic Location (Zv9):
Chromosome 16 (position 27184304)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25029991
GRCz11 16 24945023
KASP Assay ID:
2260-9661.1 (used for ordering genotyping assays)
KASP Sequence:
GGCTTTACCATATCAGCCTATCAAGAGGATCCTGCTTATCTGCGTGAGTG[T/A]CTTCAGTCGGTCCGGGCTCTTCAGTATCCTTCTGAWCTTCTGCGTATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36125
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063114 Essential Splice Site 347 571 None 4
ENSDART00000130420 Essential Splice Site 393 617 None 5
Genomic Location (Zv9):
Chromosome 16 (position 27180335)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25026022
GRCz11 16 24941054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGTTCATTTCCAACAAGCATGTTTTAACTATTGTTTTCTGTTCTCACA[A/G]GGTACACAGCCCTCTCCAAATGCTACACGGAGACCCCTGCTCAGTTTCTG
Associated Phenotype:
Not determined