Busch Lab

ZMP

cyp2j24

Ensembl ID:
ENSDARG00000042980
ZFIN ID:
ZDB-GENE-041001-155
Description:
cytochrome P450, family 2, subfamily J, polypeptide 24 [Source:RefSeq peptide;Acc:NP_001076518]
Human Orthologue:
CYP2J2
Human Description:
cytochrome P450, family 2, subfamily J, polypeptide 2 [Source:HGNC Symbol;Acc:2634]
Mouse Orthologues:
Cyp2j11-ps, Cyp2j5, Cyp2j6, Cyp2j9
Mouse Descriptions:
cytochrome P450, family 2, subfamily j, polypeptide 11, pseudogene Pseudogene [Source:MGI Symbol;Acc
cytochrome P450, family 2, subfamily j, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1270149]
cytochrome P450, family 2, subfamily j, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1270148]
cytochrome P450, family 2, subfamily j, polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:1921769]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa29364 Nonsense Mutation detected in F1 DNA Not yet available
sa44940 Nonsense Mutation detected in F1 DNA Not yet available
sa23707 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29364
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063107 Nonsense 88 496 2 9
Genomic Location (Zv9):
Chromosome 20 (position 25600202)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25671505
GRCz11 20 25570595
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTCAGCATAAGACTTTTTGGACCAAGAATTGTAGTGTTGGATGGATA[T/A]AAACTGGTAAAGGAGGTGTATTTGCAACAGGGTGACAATCTGGCTGATCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3091
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063107 Nonsense 126 496 3 9
Genomic Location (Zv9):
Chromosome 20 (position 25601358)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25672661
GRCz11 20 25571751
KASP Assay ID:
554-3436.1 (used for ordering genotyping assays)
KASP Sequence:
ATAATCTAAATTAATATTACATTAACAGGGTTAATTGGGTCCAATGGGTA[T/G]AAATGGAAGCACCAGAGACGATTTGCACTCTCAACTYTTCGAACCTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44940
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063107 Nonsense 140 496 3 9
Genomic Location (Zv9):
Chromosome 20 (position 25601398)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25672701
GRCz11 20 25571791
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAATGGGTATAAATGGAAGCACCAGAGACGATTTGCACTCTCAACTTTT[C/T]GAACCTTTGGATTGGGGAAGAAAAGTCTGGAGCCGTCCATTCTCCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23707
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063107 Nonsense 302 496 6 9
Genomic Location (Zv9):
Chromosome 20 (position 25602125)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25673428
GRCz11 20 25572518
KASP Assay ID:
2261-4335.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGCTGCAGGGTTTGATGTGGAGAACTTGTGCATCTGTACTCTGGATT[T/A]GTTTGTAGCAGGAACTGAGACCACCTCCACCACTCTGTACTGGGGTCTTC
Associated Phenotype:
Not determined