Busch Lab

ZMP

slc17a9a

Ensembl ID:
ENSDARG00000042954
ZFIN ID:
ZDB-GENE-081021-1
Human Orthologue:
SLC17A9
Human Description:
solute carrier family 17, member 9 [Source:HGNC Symbol;Acc:16192]
Mouse Orthologue:
Slc17a9
Mouse Description:
solute carrier family 17, member 9 Gene [Source:MGI Symbol;Acc:MGI:1919107]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa34387 Nonsense Mutation detected in F1 DNA Not yet available
sa21280 Essential Splice Site Available for shipment Available now
sa31653 Essential Splice Site Available for shipment Available now
sa34388 Nonsense Mutation detected in F1 DNA Not yet available
sa34389 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34387
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036801 Nonsense 62 458 2 13
Genomic Location (Zv9):
Chromosome 8 (position 24007547)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23133365
GRCz11 8 23154604
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCGGACATGGACCCTGATGCTACTGCTGGTCACATGTGTTCTCCATTG[G/A]TCACGGATGGCCATGCCGATCTGTGCCGTCACCATGGCTAGAGAATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21280
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036801 Essential Splice Site 109 458 3 13
Genomic Location (Zv9):
Chromosome 8 (position 24007757)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23133575
GRCz11 8 23154814
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGAGGCTCTAGATGATGTAGATTCTGATTATGAAGTTTTTTTTTTTTC[A/T]GGATTGGAGGAGAACGAGTGCTGCTTCTTTCCACCTCCTCATGGGGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31653
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036801 Essential Splice Site 156 458 4 13
Genomic Location (Zv9):
Chromosome 8 (position 24008878)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23134696
GRCz11 8 23155935
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAGACAATTCAGGGGCAAAGAATTTCAGTGACCATCGTTGTTATTTAC[A/T]GGTGTTCACTACCCTTCTCTGGTCAGCATCTGTTCTCAGCGGGTGACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34388
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036801 Nonsense 206 458 5 13
Genomic Location (Zv9):
Chromosome 8 (position 24009321)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23135139
GRCz11 8 23156378
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGATGCTGGTTGGAGGAGTGGGCTCCCTGATGCTGGACTGGTTTGGGT[G/A]GCAGAGTGTGTTTTATGGAGCTGGTCTCCTTGCTGTTTTCTGGGCCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34389
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036801 Essential Splice Site 337 458 9 13
Genomic Location (Zv9):
Chromosome 8 (position 24014420)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23140238
GRCz11 8 23161477
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTCATTCTGGCAGGTTGTGGGACAGCGGCTGTGAGGAAACTGATGCAG[G/A]TAACACATCAGCTATGAGTTTTCTTTGCCCTCATACTGTATACCGTATTA
Associated Phenotype:
Not determined