Busch Lab

ZMP

cyp2j30

Ensembl ID:
ENSDARG00000042953
ZFIN ID:
ZDB-GENE-041001-158
Description:
cytochrome P450, family 2, subfamily J, polypeptide 30 [Source:RefSeq peptide;Acc:NP_001007357]
Human Orthologue:
CYP2J2
Human Description:
cytochrome P450, family 2, subfamily J, polypeptide 2 [Source:HGNC Symbol;Acc:2634]
Mouse Orthologues:
Cyp2j11-ps, Cyp2j5, Cyp2j6, Cyp2j9
Mouse Descriptions:
cytochrome P450, family 2, subfamily j, polypeptide 11, pseudogene Pseudogene [Source:MGI Symbol;Acc
cytochrome P450, family 2, subfamily j, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1270149]
cytochrome P450, family 2, subfamily j, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1270148]
cytochrome P450, family 2, subfamily j, polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:1921769]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa37029 Nonsense Available for shipment Available now
sa43440 Nonsense Mutation detected in F1 DNA Not yet available
sa14047 Nonsense Available for shipment Available now
sa14367 Nonsense Available for shipment Available now
sa7470 Missense Mutation detected in F1 DNA Not yet available
sa37028 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37029
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Nonsense 3 497 1 9
Genomic Location (Zv9):
Chromosome 20 (position 25552362)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25623665
GRCz11 20 25522755
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGCTAGGCTCACGTGGTCTGTCTTCATTCACATGCAGTCATGGCGTA[T/A]ACTGCAATACTCGAGACTCTTGATGTGAAGGGAATATTGCTGTTCATGGT
Long Flanking Sequence:
CCACAAAGCATTTATTTGTGGTGTGAAAGACATTTAATTTAAATGCACCATTAATTTTTCTGAAAATTTAGTAAAGCAGAACATTATAAATTCACCAATTACTGATAGATTACTTCTAGAATAAATCATAATGTACATGAGCTCCTAAACTTGCAGTCAAAACCCTCAATCTAAATAAAGCAAAGGGCAAATGCTGGATAAATGTGTGTGGTGTGAGGACCTGATTATTAGCACTAAGCCAAAAGTCAACCTCTGTTAAAAACAAACCTGACAGTATAAACTCCAATAGTCCACCACTTGTGCTACAGAGGATAACTTTTACTCACGTACCCTGCCGGAAGATAGATGAAGATATTACATAACTCACAGTTCACAACATTACAGCTATGGAGCCAAATGTGAGGGGAGTGTCAGGCTGAACAGATGGATAAAGACAGCCTGTTCAACAAATTCTGCTAGGCTCACGTGGTCTGTCTTCATTCACATGCAGTCATGGCGTA[T/A]ACTGCAATACTCGAGACTCTTGATGTGAAGGGAATATTGCTGTTCATGGTGGCTTTTCTTTTGGTGGCAGATTACCTGAAGAACAGAAACCCACCGAAATACCCACCCAGCCCTTTCTCTGTTCCACTACTAGGAAACATCTTCAACGTTGACTCCAAAGAGCCTCATTTATATCTGACAAAGGTGAGCAGATGATATTGCCACTCCTGAATTTGATAGCACAGAAAATTACTCATTGAAATAAAGCACGAAAGTACTTTGCATTATGGCCTATGAACTTCATCAAGAGATTATTTAATCGTAGAAATAACATCTATTGATGGAATAATATTATTAATATTTATTTATAATTATGTGTATTTTATAGCATTTAATGTCTTCAAGCCTGATTTTAGGAGCTTGCTGACAAAAACACATTTTTTGACTGATTGTTTGGCATTAGCTCCAGTCACATGCCTCAAGATGACATTGTTTTGTTCACAGCTCGGCCATGCCTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43440
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Nonsense 56 497 1 9
Genomic Location (Zv9):
Chromosome 20 (position 25552205)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25623508
GRCz11 20 25522598
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGCCCTTTCTCTGTTCCACTACTAGGAAACATCTTCAACGTTGACTCC[A/T]AAGAGCCTCATTTATATCTGACAAAGGTGAGCAGATGATATTGCCACTCC
Long Flanking Sequence:
CAAAACCCTCAATCTAAATAAAGCAAAGGGCAAATGCTGGATAAATGTGTGTGGTGTGAGGACCTGATTATTAGCACTAAGCCAAAAGTCAACCTCTGTTAAAAACAAACCTGACAGTATAAACTCCAATAGTCCACCACTTGTGCTACAGAGGATAACTTTTACTCACGTACCCTGCCGGAAGATAGATGAAGATATTACATAACTCACAGTTCACAACATTACAGCTATGGAGCCAAATGTGAGGGGAGTGTCAGGCTGAACAGATGGATAAAGACAGCCTGTTCAACAAATTCTGCTAGGCTCACGTGGTCTGTCTTCATTCACATGCAGTCATGGCGTATACTGCAATACTCGAGACTCTTGATGTGAAGGGAATATTGCTGTTCATGGTGGCTTTTCTTTTGGTGGCAGATTACCTGAAGAACAGAAACCCACCGAAATACCCACCCAGCCCTTTCTCTGTTCCACTACTAGGAAACATCTTCAACGTTGACTCC[A/T]AAGAGCCTCATTTATATCTGACAAAGGTGAGCAGATGATATTGCCACTCCTGAATTTGATAGCACAGAAAATTACTCATTGAAATAAAGCACGAAAGTACTTTGCATTATGGCCTATGAACTTCATCAAGAGATTATTTAATCGTAGAAATAACATCTATTGATGGAATAATATTATTAATATTTATTTATAATTATGTGTATTTTATAGCATTTAATGTCTTCAAGCCTGATTTTAGGAGCTTGCTGACAAAAACACATTTTTTGACTGATTGTTTGGCATTAGCTCCAGTCACATGCCTCAAGATGACATTGTTTTGTTCACAGCTCGGCCATGCCTACAACAATATCTTCAGTCTTCGATTAGGAAGTGACAAAACCGTCTTCATTACTGGTTATAAAATGGTAAAGGAGGCCCTGGTGACACAAGCTGAAAACTTTGTGGATCGGCCCAACAGTCCAGTGCTAGCACGTGTGTATTCTGGAAATGGTAGGTCAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4136
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Essential Splice Site 119 497 2 9
Genomic Location (Zv9):
Chromosome 20 (position 25551714)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25623017
GRCz11 20 25522107
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGATCGGCCCAACAGTCCAGTGCTAGCACGTGTGTATTCTGGAAATGG[T/C]AGGTCAACAATGTGAAAGTGTGAAAAAAGAGAAATGCTACACATGGCCTY
Long Flanking Sequence:
GTTGACTCCAAAGAGCCTCATTTATATCTGACAAAGGTGAGCAGATGATATTGCCACTCCTGAATTTGATAGCACAGAAAATTACTCATTGAAATAAAGCACGAAAGTACTTTGCATTATGGCCTATGAACTTCATCAAGAGATTATTTAATCGTAGAAATAACATCTATTGATGGAATAATATTATTAATATTTATTTATAATTATGTGTATTTTATAGCATTTAATGTCTTCAAGCCTGATTTTAGGAGCTTGCTGACAAAAACACATTTTTTGACTGATTGTTTGGCATTAGCTCCAGTCACATGCCTCAAGATGACATTGTTTTGTTCACAGCTCGGCCATGCCTACAACAATATCTTCAGTCTTCGATTAGGAAGTGACAAAACCGTCTTCATTACTGGTTATAAAATGGTAAAGGAGGCCCTGGTGACACAAGCTGAAAACTTTGTGGATCGGCCCAACAGTCCAGTGCTAGCACGTGTGTATTCTGGAAATGG[T/C]AGGTCAACAATGTGAAAGTGTGAAAAAAGAGAAATGCTACACATGGCCTCCATGTCACACTGTAAGATCACAGTTGTCACACAGTAATGTCAGACTGAGAAACAATCAAGACGCATCAAATACAGATGAGCAAGAAAACTCACCCAGTGTGAGTTCGGCTTAGTGCCAGATTTATAAGGTGTTGCTACAGTGGAATGAACCACCAATTACTCTGGCATATCCTCCTGAGACCCCGCCCATTGACTTGTTTGCTCTGTAGTGGGCATTGCGTTTTCATGAATTTTCTTTGAATTTTTTGAGCTACTCTGCCAAGTCCTCTTGTACTGTTTAGAGGACATCCTGGGCTTTCTAGTGTTATGTCATTTGATTGGCTGGCATGCTAGGAACCACTTCTTACACTGCATCCAAAATGGCCGACATACAAAAAAAGCACATTTTATGGGAAGGAGAGATGCATGTAAATTTACCTTTTAAATGTTTTTTTCCTATTATAATTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14047
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Nonsense 170 497 3 9
ENSDART00000063058 Nonsense 170 497 3 9
Genomic Location (Zv9):
Chromosome 20 (position 25549085)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25620388
GRCz11 20 25519478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATCTGTGAGGAGAGCCGCTTTCTTCTRGAAGAGATAGACGWACAGAAA[G/T]GTATGCAACATGCTACGGTATATACTGTAWGAASTTACCAGCTTCTTGGT
Long Flanking Sequence:
TCACTGGGAAACCCATACACTCGTTCACACACGTTCACTATGGACAATTTAGCTTACCCAATTTACCTATACCACATGTCTTTGGACTTGCGGGGGAAACCGAAGCACCCGGAGGAAACCCACTCAAACACAGGATGAACATGCAAATTCCACAAATAATAATAAATAAAAAAATAAATAAAATAAATATTTAAACTGTATTGAAACATCCCAAAGCTCAAACAAAATAAATAGAAAACAACATAGGAATATATAATAATAAACAAAATAATATATTTCGATTTGCAAAAATTTATGTACCAATTTTCACTGATCATGTTAGCGAGGCCTTCTTTTTGTCCTCTGCAGCTGGACTCTTCTTCAGTAATGGTGAGATGTGGAAGAAGCAACGACGCTTCGCTCTGTCAACACTGAGGAACTTTGGATTGGGAAAGAAAACAATGGAGCTGGCCATCTGTGAGGAGAGCCGCTTTCTTCTGGAAGAGATAGACGAACAGAAA[G/T]GTATGCAACATGCTACGGTATATACTGTATGAACTTACCAGCTTCTTGGTAACTGAAAAGATTACAGATTTGGCATTAAGCTGGCACAGCAGGGCAGGCATTCATCTGGCACTGGCATATAGCATGTGGGCCAAACATGGCCCGAGTTTGGCAGAGGTGGCGTCGTCTTAAAGGCAGCACACAAGATTTGGGCCAAATGTAAAATATAGTATTTTACCCAGATGTTAAAAATTTACAAGTGGGCCATGTAAGTTTGGCCTGTCTTGACCCACATTTAAAATACATTAGAATTATTTTTGAGTTAAGAAATAAAATTCTACCAATCAAGTCTCTTTGAGAAAAAGCACGCCCATAGAGTGCTCAAAGTGCAAAATGTCATGGGTTTATCAATTTCTTTGCAATTGTGACACACCAACCAATCTGGCCCAGTTCAGGCCCAGTTATGAGTTATTAACTTGACTTAGACTTGGCCCAGGTATGGTCCATGTTTGGCCCTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14367
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Nonsense 170 497 3 9
ENSDART00000063058 Nonsense 170 497 3 9
Genomic Location (Zv9):
Chromosome 20 (position 25549085)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25620388
GRCz11 20 25519478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATCTGTGAGGAGAGCCGCTTTCTTCTRGAAGAGATAGACGWACAGAAA[G/T]GTATGCAACATGCTACGGTATATACTGTAWGAASTTACCAGCTTCTTGGT
Long Flanking Sequence:
TCACTGGGAAACCCATACACTCGTTCACACACGTTCACTATGGACAATTTAGCTTACCCAATTTACCTATACCACATGTCTTTGGACTTGCGGGGGAAACCGAAGCACCCGGAGGAAACCCACTCAAACACAGGATGAACATGCAAATTCCACAAATAATAATAAATAAAAAAATAAATAAAATAAATATTTAAACTGTATTGAAACATCCCAAAGCTCAAACAAAATAAATAGAAAACAACATAGGAATATATAATAATAAACAAAATAATATATTTCGATTTGCAAAAATTTATGTACCAATTTTCACTGATCATGTTAGCGAGGCCTTCTTTTTGTCCTCTGCAGCTGGACTCTTCTTCAGTAATGGTGAGATGTGGAAGAAGCAACGACGCTTCGCTCTGTCAACACTGAGGAACTTTGGATTGGGAAAGAAAACAATGGAGCTGGCCATCTGTGAGGAGAGCCGCTTTCTTCTGGAAGAGATAGACGAACAGAAA[G/T]GTATGCAACATGCTACGGTATATACTGTATGAACTTACCAGCTTCTTGGTAACTGAAAAGATTACAGATTTGGCATTAAGCTGGCACAGCAGGGCAGGCATTCATCTGGCACTGGCATATAGCATGTGGGCCAAACATGGCCCGAGTTTGGCAGAGGTGGCGTCGTCTTAAAGGCAGCACACAAGATTTGGGCCAAATGTAAAATATAGTATTTTACCCAGATGTTAAAAATTTACAAGTGGGCCATGTAAGTTTGGCCTGTCTTGACCCACATTTAAAATACATTAGAATTATTTTTGAGTTAAGAAATAAAATTCTACCAATCAAGTCTCTTTGAGAAAAAGCACGCCCATAGAGTGCTCAAAGTGCAAAATGTCATGGGTTTATCAATTTCTTTGCAATTGTGACACACCAACCAATCTGGCCCAGTTCAGGCCCAGTTATGAGTTATTAACTTGACTTAGACTTGGCCCAGGTATGGTCCATGTTTGGCCCTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7470
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Missense 187 497 4 9
Genomic Location (Zv9):
Chromosome 20 (position 25548043)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25619346
GRCz11 20 25518436
KASP Assay ID:
554-4045.1 (used for ordering genotyping assays)
KASP Sequence:
AGCTGCTTTTGACCCAACAATCCTATTATACAATGCTGTTTCCAATWTAA[T/A]CTGTCAAATGGTGTTTGGCCAGAGATTTGACTATGCTGACCACCAGTTCA
Long Flanking Sequence:
CGGCATGTGGGCCAAGCAAAACCTGATTGTGTGGGCCAGAGCTGGGCCAGAGAAATTTTGCTGTGTGGGCTGTGACCCCCCACCCCCACCACCACCACCACTAGCAATGCTTCTGTTTGTCTCATCACCACATGCTTTCAGTTGTGTTTTCGTCTGTGTAGTCAAGGTACGCTGATGTTAGTACTTCAAAATTTGAGTATAACACTGGAGTAATGAAATACAGTAGATTACCAGAGATTTCAATTTTCTTTTACAGTTTAAACTGTATTTTATCTGTAAAATTCTGGCCACCCCAGTTGCTTTTACTCTATTTTACAGATGTTTTTTTGCAGTGTACCTTACAAACTGGCCCTTGGCTGTACATATTCCGAAGTAAATGATTTTTGCATGCACCAGCTAGTTAAAATACATGTAACTAACACGACACATGTTGTTTTTGCCCTTTTTAGGAGCTGCTTTTGACCCAACAATCCTATTATACAATGCTGTTTCCAATATAA[T/A]CTGTCAAATGGTGTTTGGCCAGAGATTTGACTATGCTGACCACCAGTTCAAAACAATGTTAAAATATATTTCTAAAAGCATTCAACTAGAAGGATCCGTTTGGGGACAGGTAAATCGATGAATGACTTCGCTTCAAATATTTAATTCACTAACTCATCAATTCAATCAATCAATGGTCTTACAATTTTTATATCCTTATAATGTAACAGCTTATAAAAATAAACAATGTTCATTTGTATTTATTAGATCTATGAAGCATTTCCAGCCATTATGAAGCATCTTCCAGGGCCTCACAATGATATTTTCAGTAACTATGACTTACTGAAGAGCTTCGTACATGAGGTCATTGTAAAACACAAGGCTAAACTGGATCCCTCAGAGCCTCGTGACTACATCGATACCTTCCTAATCGAGATGAAGGAGGTAAAATAATGCTTAAATGACAGAAGAAGCCTCTTTAACTTATGCTCTTATGTTTAAACAGAAAATTATTTCACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37028
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063058 Nonsense 451 497 9 9
Genomic Location (Zv9):
Chromosome 20 (position 25545194)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25616497
GRCz11 20 25515587
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTCTCTCTTTCACAGGAAAGAGGGTCTGTTTGGGGGAGCAGATCGCC[A/T]GAATTGAACTCTTCCTATTTTTTGTCAGTTTGTTCCGCAAATTCAGATTT
Long Flanking Sequence:
TTAAAGATTTGGGTTCAGTATGGTAAAATAAAAAAGTAATTAATACTTTTATTGAGCAATGATTTATTAAAATGATCAAGAGTTTAATATTGTCACAAAATTAATATTCTCAAATGTTCTATTCATGTTAGAATCTCAACTGAACTTTCTGAAAATTGAAATGATCAAAAATGTTTCTTGAACACCAGATCAACACTTTAAAAATGACATGGAAATCCTTTATAAAATATATCAAAATAGAATGTTTTTTTAATGTTTTTGATTGACAAAATACAGCCTTGTTTTGCATAGCACTTAATAAATAATTAAATTAATAAATTATAATAATGATTTTTATATAATAATAATAATAAAACAAAAACCTTACTTGCCCCAAATTTCTTCAGTATTCTACATCAGAGACAAACTGAAAATGATTATAGACTTGTTTGCATTAACATCTGCTTGCTCTGTGTCTCTCTTTCACAGGAAAGAGGGTCTGTTTGGGGGAGCAGATCGCC[A/T]GAATTGAACTCTTCCTATTTTTTGTCAGTTTGTTCCGCAAATTCAGATTTTCAGCCACAGAGGGAGAGAAACTCAACATGGATGGAGTGATTGGAATAACACGCACTCCACACCCGTTCAAGATCTGTGCAACAGCACGTTGAGACAAATCTGACTATTTTTATTAGGAATTAATGAACAATATTTATAGTCAATTACAGTACATTATATGTATCTAACATGACACTACTGGCAATTTTTATTTCACATTTTGGGCTTTTTGACTTCATAAATTGTTTTTCTTTTCCTGGCTTTATTGAAAATAAACACCTAAAAAAGTGTTTCTTTATTAATTGTTTCTGTGCATATTATTTAAAGCTCTTTTCTCCTAAATAGATTTTTTAGCAGTACTTACAGTATAAAGTAAAACTTCACCACTTTGTTCACATGGGCTTTAAGAAGGATCTTCAGAAGGATATGTTCATTTGGGCTGAATATATACAACATTTAATTCTACAATT
Associated Phenotype:
Not determined