Busch Lab

ZMP

hook1

Ensembl ID:
ENSDARG00000042946
ZFIN ID:
ZDB-GENE-041001-159
Description:
Protein Hook homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5TZ80]
Human Orthologue:
HOOK1
Human Description:
hook homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19884]
Mouse Orthologue:
Hook1
Mouse Description:
hook homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925213]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37027 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23706 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37027
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063052 Essential Splice Site 44 715 2 22
Genomic Location (Zv9):
Chromosome 20 (position 25519302)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25590605
GRCz11 20 25489695
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGGATCTGACCTCAGGAGCAGCCATGTCTCAGGCTCTGCATCAGATG[T/C]GAGTGTGTCACATTTATTCACTGGCAGACTAGCTTATGTCCTAAGCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23706
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063052 Nonsense 321 715 11 22
Genomic Location (Zv9):
Chromosome 20 (position 25528882)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25600185
GRCz11 20 25499275
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGCTCTGACCGGGCAGTGAAGCTCGAGGCCTCTGTTGAGACCTACAGA[A/T]AGAAGTTGGAAGATTTAAGTGACCTCAGACGACAAATGAAAGCTCTGGAA
Associated Phenotype:
Not determined