Busch Lab

ZMP

ctgf

Ensembl ID:
ENSDARG00000042934
ZFIN ID:
ZDB-GENE-030131-102
Description:
connective tissue growth factor [Source:RefSeq peptide;Acc:NP_001015041]
Human Orthologue:
CTGF
Human Description:
connective tissue growth factor [Source:HGNC Symbol;Acc:2500]
Mouse Orthologue:
Ctgf
Mouse Description:
connective tissue growth factor Gene [Source:MGI Symbol;Acc:MGI:95537]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa25135 Nonsense Mutation detected in F1 DNA Not yet available
sa13699 Nonsense Available for shipment Available now
sa11839 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25135
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063028 Nonsense 184 345 4 5
Genomic Location (Zv9):
Chromosome 20 (position 25371609)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25442912
GRCz11 20 25342002
KASP Assay ID:
554-7641.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAGTAACATCTTATTGCTTCTTGTAGCTTACAGAGAGGAGGAGACATA[C/A]GGTCCCGATCCCTCCATGATGAGAGAGAACTGCCTGGTTCAGACTACAGA
Long Flanking Sequence:
AACAATCTTCCATCTCCGTCCCACAGCCAGAGATGGTGCCACTTGTGTGTTTGGTGGAATGGTGTACCGCAGTGGAGAGTCTTTCCAGAGCAGTTGTAAATACCAGTGCACGTGTCTGGACGGTGCTGTAGGTTGCGTGCCCCTCTGTGGAATGGACATCAGGCTCCCCAGCCCAGACTGCCCAATGCCCCGCAGGGTGAAAGTGCCTGGGAAGTGCTGCGAGGAGTGGGTGTGTGACTCCCCTCGTCAAAACACCTTTGTGGGATCAGCTTTAGCAGGTGAGCATTTCTCAATCTTAAAAGCCAAACTGTGATGGAAAAATTACTCCTAAAGAATGTATTTAGACAAAGTAATGGTCTTGGTATTAGGGGGTTTAGAATGAATATCAGTATAACATCAGATGTAACAATAAGAATAGCAGGATGACATCATGCTGTTGGATGGAATGTGTTGAGTAACATCTTATTGCTTCTTGTAGCTTACAGAGAGGAGGAGACATA[C/A]GGTCCCGATCCCTCCATGATGAGAGAGAACTGCCTGGTTCAGACTACAGAATGGAGCGCATGCTCAAAAACCTGTGGCTTGGGAATCTCTACTCGTGTGACCAATGACAACCGTGAGTGCCGCCTTGAGAAGCAGTCTCGCCTTTGCATGGTCCGCCCTTGCGAGTCACACCTGGAGGAGAAAATAAGGGTAAGGGGCTATCTACCGATAAAATGAAATCATGCCACAGCTTCAATCTTGCTTTCACCGTGATGTAACTGAGCTTTATGGTTAACCTTCATTTTTTATCTTTCCAGAAAGGGAAAAAGTGCATCCGCACACCACGAGTCTCCAAACCCATGAAGTTTGAGATTTCCGGCTGTACCACTACCAAGTCTTACAGACCCAAGTTCTGCGGCGTTTGCACAGATGGTCGCTGTTGCACTCCTCACAGAACCGCCACCTTGCCCATGGAGTTCAAGTGCCCCGATGGCCAAGTCATGAAGAAGCAGATGATGTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7934
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063028 Nonsense 250 345 5 5
Genomic Location (Zv9):
Chromosome 20 (position 25371912)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25443215
GRCz11 20 25342305
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTAACTGAGCTTTATGGTTAACCTTCATTTTTTATCTTTCCAGAAAGGG[A/T]AAAAGTGCATCCGCACACCAMGAGTCTCCAAACCCATGAAGTTTGAGATT
Long Flanking Sequence:
CAAACTGTGATGGAAAAATTACTCCTAAAGAATGTATTTAGACAAAGTAATGGTCTTGGTATTAGGGGGTTTAGAATGAATATCAGTATAACATCAGATGTAACAATAAGAATAGCAGGATGACATCATGCTGTTGGATGGAATGTGTTGAGTAACATCTTATTGCTTCTTGTAGCTTACAGAGAGGAGGAGACATACGGTCCCGATCCCTCCATGATGAGAGAGAACTGCCTGGTTCAGACTACAGAATGGAGCGCATGCTCAAAAACCTGTGGCTTGGGAATCTCTACTCGTGTGACCAATGACAACCGTGAGTGCCGCCTTGAGAAGCAGTCTCGCCTTTGCATGGTCCGCCCTTGCGAGTCACACCTGGAGGAGAAAATAAGGGTAAGGGGCTATCTACCGATAAAATGAAATCATGCCACAGCTTCAATCTTGCTTTCACCGTGATGTAACTGAGCTTTATGGTTAACCTTCATTTTTTATCTTTCCAGAAAGGG[A/T]AAAAGTGCATCCGCACACCACGAGTCTCCAAACCCATGAAGTTTGAGATTTCCGGCTGTACCACTACCAAGTCTTACAGACCCAAGTTCTGCGGCGTTTGCACAGATGGTCGCTGTTGCACTCCTCACAGAACCGCCACCTTGCCCATGGAGTTCAAGTGCCCCGATGGCCAAGTCATGAAGAAGCAGATGATGTTCATCAAGACCTGCGCATGCCACTACAACTGCCCTGGGGAGAACGACATCTTTGAATCCATGTACTACAAGAAGATGGTTGGCGACATGGCGTGAAAAGTCATGACCTGACAAGGAGTTCCATGCAGTGACTGTCCACTTGAATTGAACAGATATCCATCTCATATCTCAGCACAAATTACTTGTTTGTCTTTTTATGGTTTGTTGCTTTCATTTTACGTCTTTTTGCGTGTATGTGTTTGCATCTTGTTGGTGGACTCTGGATTTCTATGCTGTATGTGTATTCATTTGTCATGGTGGATGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13699
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063028 Nonsense 260 345 5 5
ENSDART00000063028 Nonsense 260 345 5 5
Genomic Location (Zv9):
Chromosome 20 (position 25371942)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25443245
GRCz11 20 25342335
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTATCTTTCCAGAAAGGGWAAAAGTGCATCCGCACACCAMGAGTCTCC[A/T]AACCCATGAAGTTTGAGATTWCCGGCTGTACCACTACCAAGTCTTACAGA
Long Flanking Sequence:
AATGTATTTAGACAAAGTAATGGTCTTGGTATTAGGGGGTTTAGAATGAATATCAGTATAACATCAGATGTAACAATAAGAATAGCAGGATGACATCATGCTGTTGGATGGAATGTGTTGAGTAACATCTTATTGCTTCTTGTAGCTTACAGAGAGGAGGAGACATACGGTCCCGATCCCTCCATGATGAGAGAGAACTGCCTGGTTCAGACTACAGAATGGAGCGCATGCTCAAAAACCTGTGGCTTGGGAATCTCTACTCGTGTGACCAATGACAACCGTGAGTGCCGCCTTGAGAAGCAGTCTCGCCTTTGCATGGTCCGCCCTTGCGAGTCACACCTGGAGGAGAAAATAAGGGTAAGGGGCTATCTACCGATAAAATGAAATCATGCCACAGCTTCAATCTTGCTTTCACCGTGATGTAACTGAGCTTTATGGTTAACCTTCATTTTTTATCTTTCCAGAAAGGGAAAAAGTGCATCCGCACACCACGAGTCTCC[A/T]AACCCATGAAGTTTGAGATTTCCGGCTGTACCACTACCAAGTCTTACAGACCCAAGTTCTGCGGCGTTTGCACAGATGGTCGCTGTTGCACTCCTCACAGAACCGCCACCTTGCCCATGGAGTTCAAGTGCCCCGATGGCCAAGTCATGAAGAAGCAGATGATGTTCATCAAGACCTGCGCATGCCACTACAACTGCCCTGGGGAGAACGACATCTTTGAATCCATGTACTACAAGAAGATGGTTGGCGACATGGCGTGAAAAGTCATGACCTGACAAGGAGTTCCATGCAGTGACTGTCCACTTGAATTGAACAGATATCCATCTCATATCTCAGCACAAATTACTTGTTTGTCTTTTTATGGTTTGTTGCTTTCATTTTACGTCTTTTTGCGTGTATGTGTTTGCATCTTGTTGGTGGACTCTGGATTTCTATGCTGTATGTGTATTCATTTGTCATGGTGGATGTCTAAGCCTAGGGGGTGGGGATCGTAAAATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11839
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063028 Nonsense 260 345 5 5
ENSDART00000063028 Nonsense 260 345 5 5
Genomic Location (Zv9):
Chromosome 20 (position 25371942)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25443245
GRCz11 20 25342335
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTATCTTTCCAGAAAGGGWAAAAGTGCATCCGCACACCAMGAGTCTCC[A/T]AACCCATGAAGTTTGAGATTWCCGGCTGTACCACTACCAAGTCTTACAGA
Long Flanking Sequence:
AATGTATTTAGACAAAGTAATGGTCTTGGTATTAGGGGGTTTAGAATGAATATCAGTATAACATCAGATGTAACAATAAGAATAGCAGGATGACATCATGCTGTTGGATGGAATGTGTTGAGTAACATCTTATTGCTTCTTGTAGCTTACAGAGAGGAGGAGACATACGGTCCCGATCCCTCCATGATGAGAGAGAACTGCCTGGTTCAGACTACAGAATGGAGCGCATGCTCAAAAACCTGTGGCTTGGGAATCTCTACTCGTGTGACCAATGACAACCGTGAGTGCCGCCTTGAGAAGCAGTCTCGCCTTTGCATGGTCCGCCCTTGCGAGTCACACCTGGAGGAGAAAATAAGGGTAAGGGGCTATCTACCGATAAAATGAAATCATGCCACAGCTTCAATCTTGCTTTCACCGTGATGTAACTGAGCTTTATGGTTAACCTTCATTTTTTATCTTTCCAGAAAGGGAAAAAGTGCATCCGCACACCACGAGTCTCC[A/T]AACCCATGAAGTTTGAGATTTCCGGCTGTACCACTACCAAGTCTTACAGACCCAAGTTCTGCGGCGTTTGCACAGATGGTCGCTGTTGCACTCCTCACAGAACCGCCACCTTGCCCATGGAGTTCAAGTGCCCCGATGGCCAAGTCATGAAGAAGCAGATGATGTTCATCAAGACCTGCGCATGCCACTACAACTGCCCTGGGGAGAACGACATCTTTGAATCCATGTACTACAAGAAGATGGTTGGCGACATGGCGTGAAAAGTCATGACCTGACAAGGAGTTCCATGCAGTGACTGTCCACTTGAATTGAACAGATATCCATCTCATATCTCAGCACAAATTACTTGTTTGTCTTTTTATGGTTTGTTGCTTTCATTTTACGTCTTTTTGCGTGTATGTGTTTGCATCTTGTTGGTGGACTCTGGATTTCTATGCTGTATGTGTATTCATTTGTCATGGTGGATGTCTAAGCCTAGGGGGTGGGGATCGTAAAATGAC
Associated Phenotype:
Not determined