Busch Lab

ZMP

foxo3b

Ensembl ID:
ENSDARG00000042904
ZFIN ID:
ZDB-GENE-990708-6
Description:
forkhead box protein O3 [Source:RefSeq peptide;Acc:NP_571160]
Human Orthologue:
FOXO3
Human Description:
forkhead box O3 [Source:HGNC Symbol;Acc:3821]
Mouse Orthologue:
Foxo3
Mouse Description:
forkhead box O3 Gene [Source:MGI Symbol;Acc:MGI:1890081]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa37075 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37075
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062982 Nonsense 23 651 2 4
ENSDART00000125597 Nonsense 23 204 1 3
ENSDART00000126370 Nonsense 23 651 1 3
Genomic Location (Zv9):
Chromosome 20 (position 32369987)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32428227
GRCz11 20 32331106
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGCCACTGTCCTCTCTGGACATTGCCATTGATCCAGATTTTGAGCCA[C/T]AGAAACGGCCGAGATCATGCACTTGGCCTCTGCCCGAGTCCAGCATGGCT
Associated Phenotype:
Not determined