Busch Lab

ZMP

osmr

Ensembl ID:
ENSDARG00000042903
ZFIN ID:
ZDB-GENE-060526-48
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2CE45]
Human Orthologue:
OSMR
Human Description:
oncostatin M receptor [Source:HGNC Symbol;Acc:8507]
Mouse Orthologue:
Osmr
Mouse Description:
oncostatin M receptor Gene [Source:MGI Symbol;Acc:MGI:1330819]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa20341 Nonsense Available for shipment Available now
sa33529 Nonsense Available for shipment Available now
sa723 Essential Splice Site Available for shipment Available now
sa20340 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20341
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097178 Nonsense 83 674 3 12
ENSDART00000133270 Nonsense 48 781 2 13
Genomic Location (Zv9):
Chromosome 5 (position 7804188)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 7994873
GRCz11 5 8499511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTATTCAACTGTAGATAATTGATTTTTTTACTGGTTTTCCTGCAGGC[G/T]AGGTGAGCTCGGATGAAATCCTGCTGTTTCCAGATGACCAGGTGTTACGT
Long Flanking Sequence:
GGATTTTCCTGTCCGTAAATGAGCAAAAATGAGTTCTGACACGCCCTGCGTTTTGCGCTCTGTGCATGGACCGTCAAAATAGAACCATAATAGTTTTAATAACTCATTTCTAATAATTGATTTATTTTATCTTTGTCCTAATGATAATAAATAATATTTGACAAGTTTTTTTTTTCTAGATACTAGTATTCAACTTTAAGTGACATTTAAAGGCATAACTAGGTTAATTAGGTTAACTAGGCAAGTGATTGGATAGCCATAGCTCATAATTTTGACCTTAAAATGCTTTTTAAAATATTAAAAACTGCTTTTATTTTAGCCAAAATAAAACAAATAAGACTTTCTCCAGAAGAAAAAAATATTATAGGAAATACTGTGAAAAATACCTGGCTCTGTTAAACACCATTTGGGAAATATATAAAAAAAGAAATTCACAAGAGGGCTAATAGTTTTGTATTCAACTGTAGATAATTGATTTTTTTACTGGTTTTCCTGCAGGC[G/T]AGGTGAGCTCGGATGAAATCCTGCTGTTTCCAGATGACCAGGTGTTACGTGAAGGCTCAACGGTGATGTTCTGCTGTGTTTATCCCAGAGACACTTCACACATCAGCTCAATGTTCTTGGGCAACACTGCCTACAAAGTCATCAACATCAGCCCCCGAGTCAAAGCCATTCGAGTGGACAACCTCAAAGCCACCAATACATACGGCGTCAACTTCTACTGCGATTTGACCAGTGATGTAGCTTATAACTTTGTCACTTGTGAGTATTTCAGATGAAATCTTTTATTATTAACTATTAGGTAAACACTAAACATATCTGTTAATTAACAGTTGATGTATTTTGAGATCTGCGGGTGTTTTTGGTTATGAATTGCATTATGGGATGTTGATCTCTGCTCTTTCGACTTTTTATGTTGAAAATTAAACTGCAGCAAGGTTGTAATAGTTTTGGATTTTTCATTAGCTTTAGTTTCTATTTGGTTTTGACTTTTTGTTTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33529
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097178 Nonsense 247 674 5 12
ENSDART00000133270 Nonsense 212 781 4 13
Genomic Location (Zv9):
Chromosome 5 (position 7797339)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8001722
GRCz11 5 8506360
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGCCACATCAGATCACCTACAACGTCACCTTACTTGTGAGAAACAGTT[T/A]GGGACGAGAGAGCGAATCTGACATATTCAATATCACAGACAGAGGTGAAT
Long Flanking Sequence:
AGATGTCCATTTGAGTATTAGTAGACTGTCTGCTTAATACATGTTGATAGTGCTCTTTTAACAGACATTTAACAGACTATAAGAAGCTTTGTAAGTACATGTGAACTTACACTAACCCCAACCCTAACAGTCTACTTATAATCTAATGAGAATCAGCATGTAGGCATGTAGATTCAATTTAACCTAAATTCAACAAACGGACCATCAAAATAAAGTGTGACCGGCGGTTATAATAATGCAATCCAGTGACATGAGTAAATGGTGACAGAATTATAATTTCTGGGTGAACTATCCCTTTATCTGGTTTCAAAAGAGATAAACTGGCACTTATTTCAGTGTTAACTCATTTTAAGTTAAATAAAACTCACTTTACCATCCTTTTCTTCTTGTTTTCAGTGACTCCAGAACTGTAAGCTGTAATTTCAATCCTCCATCCTGCAGTTTTAAAGTTGTGCCACATCAGATCACCTACAACGTCACCTTACTTGTGAGAAACAGTT[T/A]GGGACGAGAGAGCGAATCTGACATATTCAATATCACAGACAGAGGTGAATATGAGCTAAAATACACTTTGAGATTGAGGATCATAAACTGTATCGCTCAGTCGGAGTTTAAAGATCTAGGTCAGAAAAACAAAAGGTTGTAAGTTGAAACCACATGAAAAGATGCTTTCGGTTGATTGGAGTAAAAGTCGACAAAAGAGACACGTTATCATTTACAGCTGGCATTCAAATGCGTCTCTTTTGTCCACTTTCTGATAAGGGTGTTTTTGCTTTTTCTGTTTCTCCTGGCCTTCTGAGGGTTGCCAAAAATTTCGAGTTCAGAACCAAACGATACAGAAATTCTACAAAGGTCAATTTCCTGCTTACATTTTTAAAAACCTTCTAACGGATAGGACAGTAGAGAGTATTGACAGAAAAGCATGAGGAGCAGAGCGAGGAGAAGGATTGGCCTAAGACCTCAAGGCAGGAATTGAACTCGGGTCGCTGTGAGCACCGGAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa723
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097178 Essential Splice Site 382 674 8 12
ENSDART00000133270 Essential Splice Site 347 781 7 13
Genomic Location (Zv9):
Chromosome 5 (position 7790841)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8008220
GRCz11 5 8512858
KASP Assay ID:
554-0631.1 (used for ordering genotyping assays)
KASP Sequence:
ACAAATCAAGAAACATCCCAATCGCAACATCACACTTCTGTGGAAACCTG[T/C]AAGTTTATTTTTCTTATCCTTTTTGTCATCAACTAAACANNNCAGCATGA
Long Flanking Sequence:
TTTGTGGCATACTTAAAAAAATAAAGGTGATTTAGTGTTTAAAAATGTTTCATTTTTAATATTTTTTAAATTTATTAATTTTTTTTCTTTCTTTCTCTTTTTTTCTTTCTTTCTCTTTCTTTCTCTTTCTTTCTTTTTCTCTTTCTTTCTTTCTTTCTTTCTTTTTCTCTTTCTTTCTTTCTTTCTTTCTTTTTCTCTTTCTTTCTTTATTTCTCTTTCTTTCTTTATTTCTTTCTTTCTTTCTTCCTTTCTTTCTTTCTTTCTTTCTCTTTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCTTTTTTCTTTCTTTCTTACTTTATTTCTTTCTTTTTCTATTTTTCTCTTTTTCTCTTTTTTTCTTTCTTTCTTTCTTTCTCTCTTTCTTTCTGCAGAGCCTCTAGTGACTGTAGAACTGTGGAGACAAATCAAGAAACATCCCAATCGCAACATCACACTTCTGTGGAAACCTG[T/C]AAGTTTATTTTTCTTATCCTTTTTGTCATCAACTAAACAGCACAGCATGAGATTAAACACGTATTTTCTTTTAACCACATTATCTTAGTGTCAAGAAACGGTTAAATTCACAGTTTAAATCAGGGGTTTCTAAACTCAGTCCTGGAGGGCCGGATCCCTGTATAGTTTAGTTCAACTCCAGTTAAACACAATTCAGTTTTTATATGGAACTCAGTTTCAATCCATTAAGTATTTTTTTATTTTTAGAAAGATGAGTACCTCAGACAGCACAGCACCTGCTTGATTTGATCACCTGCCATTTCAGTGGATCTGAAAGCAGGACTTATCTGACTAAAAATGGGCTTATGAAGGAATAATGTAAAGGGGCTCTATTATATTTAACAGTTTCTTAAAACCCGACATTTTCACTACCGATTAAGATCTCTCAGATGTATTTTTCCACCACTCTCTTGGTAGCGGTGTTGGTGCGCGATATATCGGCGGTGTGGGCGTGTGTGTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26399
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097178 Nonsense 556 674 11 12
ENSDART00000133270 Nonsense 521 781 10 13
Genomic Location (Zv9):
Chromosome 5 (position 7786011)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8013050
GRCz11 5 8517688
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATGTTTTTAAGCTTCGTATTTGAATGTTTTGCAGGGCCAAAGCAGTA[C/A]CCAACACTGCTCTCTCATCCAGACATCACCTGCTCATCTGTAAACCTGAC
Long Flanking Sequence:
TCTGTTTCCAGCCATCTTACCCAAACAAAAACTGTCTGTTGTGCTGCTTGATATTGAAAATATGCAGTTCTTTTTGTTTATTTTGAGCTTCAAAATGTGCCACACACCCTCTATTGGAGACAGGTCGGGATGGCAGACAGGCCAGTCAAGTACCTGTAACCTCTTCCTCTGCAGCCAGGACTTTGAACAACAATAACAACAACATCTACCATAGACAACAAATAAGTCTGGCAGTGCTTATATAATGTCTGAGTTCTTGATTATGCAGAGCTCGTCCTGACTGAAATGCAGAAAACTCCAACACTTCTCCAGAATGATCTGATAGACTGTGAAGCTCATCCTGAAAATCAGGACTACCATTAGAAGAAGGAAAACTAATAAATTCAATAGAGTGTCTCAACTTTTTCACATGACCGTATATCACAATTGAACATTTCATTCATTAAGTTCAAAATGTTTTTAAGCTTCGTATTTGAATGTTTTGCAGGGCCAAAGCAGTA[C/A]CCAACACTGCTCTCTCATCCAGACATCACCTGCTCATCTGTAAACCTGACATGGAGATTTAATGAGCAGGATCCCAAACACCCTGGATTCATTACAGGATATGTGATCAGAGTCCGTTCAGAAAGCGGTTCTGAACTCCGTGAGTGTGACATTGCTCCTAAATGAGAAATTAAACACTCACTACACTGCAAAAAATTTATCTTGTTTCTAGTGCAAATATCTAAAAATTCTTAAATCAAAAATAATTTTTTAGAAAATAAATAATAATAAATAAATAAAAAAGAATAGAATAATAAAATGTTGTTTTGTTTTCAGAAATAATCCGTCATAATTAAGTTACAACAAGTAAAAATTCTCCCAGTGGGGTAAGTTAATTAAACTTATTTCAATGTCAAACCAAAGAAAATGGAATATTTTATTTATCCCACTGGCAGTTTTTTAAAGGAAAAACTCACTTAATTTTGACTTACAGTGCACCCGGTAAGTATTAATAGCGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20340
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097178 Essential Splice Site 602 674 11 12
ENSDART00000133270 Essential Splice Site 567 781 10 13
Genomic Location (Zv9):
Chromosome 5 (position 7785871)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8013190
GRCz11 5 8517828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTACAGGATATGTGATCAGAGTCCGTTCAGAAAGCGGTTCTGAACTCC[G/A]TGAGTGTGACATTGCTCCTAAATGAGAAATTAAACACTCACTACACTGCA
Long Flanking Sequence:
GCCAGTCAAGTACCTGTAACCTCTTCCTCTGCAGCCAGGACTTTGAACAACAATAACAACAACATCTACCATAGACAACAAATAAGTCTGGCAGTGCTTATATAATGTCTGAGTTCTTGATTATGCAGAGCTCGTCCTGACTGAAATGCAGAAAACTCCAACACTTCTCCAGAATGATCTGATAGACTGTGAAGCTCATCCTGAAAATCAGGACTACCATTAGAAGAAGGAAAACTAATAAATTCAATAGAGTGTCTCAACTTTTTCACATGACCGTATATCACAATTGAACATTTCATTCATTAAGTTCAAAATGTTTTTAAGCTTCGTATTTGAATGTTTTGCAGGGCCAAAGCAGTACCCAACACTGCTCTCTCATCCAGACATCACCTGCTCATCTGTAAACCTGACATGGAGATTTAATGAGCAGGATCCCAAACACCCTGGATTCATTACAGGATATGTGATCAGAGTCCGTTCAGAAAGCGGTTCTGAACTCC[G/A]TGAGTGTGACATTGCTCCTAAATGAGAAATTAAACACTCACTACACTGCAAAAAATTTATCTTGTTTCTAGTGCAAATATCTAAAAATTCTTAAATCAAAAATAATTTTTTAGAAAATAAATAATAATAAATAAATAAAAAAGAATAGAATAATAAAATGTTGTTTTGTTTTCAGAAATAATCCGTCATAATTAAGTTACAACAAGTAAAAATTCTCCCAGTGGGGTAAGTTAATTAAACTTATTTCAATGTCAAACCAAAGAAAATGGAATATTTTATTTATCCCACTGGCAGTTTTTTAAAGGAAAAACTCACTTAATTTTGACTTACAGTGCACCCGGTAAGTATTAATAGCGCTTCACTTTTTTCCACATTTTTTTAACGTTACAGCCTTATTTCAAAATGGATTAAATAAATGTATTTCCTCAAAATTTGACACACAATACCCCATAATGACAATGTGAAAAAAGATTTGTTGAATCGGTTGCAAATTTATTATA
Associated Phenotype:
Not determined