Busch Lab

ZMP

lace1b

Ensembl ID:
ENSDARG00000042902
ZFIN ID:
ZDB-GENE-041014-178
Description:
Lactation elevated protein 1 homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q5TYS0]
Human Orthologue:
LACE1
Human Description:
lactation elevated 1 [Source:HGNC Symbol;Acc:16411]
Mouse Orthologue:
Lace1
Mouse Description:
lactation elevated 1 Gene [Source:MGI Symbol;Acc:MGI:2148801]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa19238 Nonsense Mutation detected in F1 DNA Not yet available
sa44944 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17857 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19238
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062978 Nonsense 77 503 2 13
ENSDART00000123973 Nonsense 90 516 2 13
Genomic Location (Zv9):
Chromosome 20 (position 32442454)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32500694
GRCz11 20 32403573
KASP Assay ID:
2261-4560.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACACTATGACAGCCTTGTCCACTTCGGTTCACTCCGAAAGGACCCGCAA[C/T]AGAGAACTGCACTTCTTCAGTTAGAAGAATTAACCAGAGTGCTGACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44944
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062978 Essential Splice Site 161 503 3 13
ENSDART00000123973 Essential Splice Site 174 516 3 13
Genomic Location (Zv9):
Chromosome 20 (position 32438438)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32496678
GRCz11 20 32399557
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCTCTAAGCCACATCCACCCCAAGGTTATTATATCTATGGTAATGTTG[G/A]TAAGTGCCACAGCAGCAGAACACTTATTCATTTTTAAACAGGCATATCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17857
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062978 Essential Splice Site 238 503 5 13
ENSDART00000123973 Essential Splice Site 251 516 5 13
Genomic Location (Zv9):
Chromosome 20 (position 32436983)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32495223
GRCz11 20 32398102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATGGAGATTGCAGAGGAAACCTGTCTCATATGCTTTGATGAGTTTCAG[G/A]TRAGGGCAGAAGTAGGGAAATTGTAAAAAAAAAAAAAAAAATTGTTGAWG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4103
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062978 Nonsense 466 503 13 13
ENSDART00000123973 Nonsense 479 516 13 13
Genomic Location (Zv9):
Chromosome 20 (position 32376804)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 32435044
GRCz11 20 32337923
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATAATAACTGCTTATTAAAATTCATTTATTTGTTCAGGAGGCCAGYAAG[C/T]GAATTACTCTGTTCACTGCGGATGAAGAGATCTTTGCCTTCCAGAGGACA
Associated Phenotype:
Not determined