Busch Lab

ZMP

si:ch211-163l21.8

Ensembl ID:
ENSDARG00000042899
ZFIN ID:
ZDB-GENE-041008-93
Description:
Novel protein (Im:7136654) [Source:UniProtKB/TrEMBL;Acc:A8Y5S9]
Human Orthologue:
KIAA1324
Human Description:
KIAA1324 [Source:HGNC Symbol;Acc:29618]
Mouse Orthologue:
5330417C22Rik
Mouse Description:
RIKEN cDNA 5330417C22 gene Gene [Source:MGI Symbol;Acc:MGI:1923930]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa34396 Nonsense Mutation detected in F1 DNA Not yet available
sa21284 Essential Splice Site Available for shipment Available now
sa27198 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa34397 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8314
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062968 None None 906 None 21
ENSDART00000124686 None None 190 None 7
ENSDART00000137820 None None 309 None 8
ENSDART00000144229 Nonsense 39 593 1 13
Genomic Location (Zv9):
Chromosome 8 (position 24642038)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23767856
GRCz11 8 23789095
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAACAAACCAGAGACCTGCACTGGCCTGCCTGACCCAGTCAAAGGCACA[C/T]AATGCAGTGAGTAATGACGATAAACACAAGCATTACTTGAAACAAACSTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34396
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062968 Nonsense 243 906 7 21
ENSDART00000124686 Nonsense 112 190 4 7
ENSDART00000137820 None None 309 None 8
ENSDART00000144229 Nonsense 282 593 7 13
Genomic Location (Zv9):
Chromosome 8 (position 24648006)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23773824
GRCz11 8 23795063
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGGAGCTTGTACACAGAGACCGGCCTGCAAAACCTCTGATTACTTCTA[C/A]ACCCACACACCCTGTGATTCCAGCGCTCAGGTAACATGTAAAAACAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21284
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062968 Essential Splice Site 253 906 None 21
ENSDART00000124686 Essential Splice Site 122 190 None 7
ENSDART00000137820 None None 309 None 8
ENSDART00000144229 Essential Splice Site 292 593 None 13
Genomic Location (Zv9):
Chromosome 8 (position 24648038)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23773856
GRCz11 8 23795095
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCTCTGATTACTTCTACACCCACACACCCTGTGATTCCAGCGCTCAGG[T/C]AACATGTAAAAACAAACACTGATAGTCTTTGTGTCGGAAAGCACTAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27198
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062968 Splice Site, Nonsense 554 906 13 21
ENSDART00000124686 None None 190 None 7
ENSDART00000137820 None None 309 None 8
ENSDART00000144229 Nonsense 593 593 13 13
Genomic Location (Zv9):
Chromosome 8 (position 24653973)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23779791
GRCz11 8 23801030
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTCGGAAAAGAAGCCTGCATTCCTTGTGGACCTAATACATACAGCAAT[A/T]AAGTAGGCACTACCTATGATTAATTAAATGTTGATTGATTATTATACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34397
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062968 Nonsense 759 906 18 21
ENSDART00000124686 None None 190 None 7
ENSDART00000137820 Nonsense 161 309 5 8
ENSDART00000144229 None None 593 None 13
Genomic Location (Zv9):
Chromosome 8 (position 24657183)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23783001
GRCz11 8 23804240
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTGTGGCGCTCACAGCAGGCCTGTCCTCTCTGCTCAGAAAGTAACTAT[A/T]AGGAGATTGTCAGCGCCTGCATCCAGGGAATTCAGGTGCAGAAAACATTC
Associated Phenotype:
Not determined