Busch Lab

ZMP

heca

Ensembl ID:
ENSDARG00000042877
ZFIN ID:
ZDB-GENE-041001-173
Description:
headcase protein homolog [Source:RefSeq peptide;Acc:NP_001038591]
Human Orthologue:
HECA
Human Description:
headcase homolog (Drosophila) [Source:HGNC Symbol;Acc:21041]
Mouse Orthologue:
Heca
Mouse Description:
headcase homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2685715]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa37115 Nonsense Mutation detected in F1 DNA Not yet available
sa18612 Nonsense Available for shipment Available now
sa3059 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa37115
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062935 Nonsense 39 523 1 4
Genomic Location (Zv9):
Chromosome 20 (position 36845826)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36918339
GRCz11 20 36821218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAAATGGAGCCTCTGCGTCTGGGGTTACGGGAGGAACTGCCTCGACGT[T/A]GACCGGAGCCACGGCGGGTCCGCCGAGCGACAACAGAAGCGGTAAGAACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3070
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062935 Nonsense 94 523 2 4
Genomic Location (Zv9):
Chromosome 20 (position 36853304)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36925817
GRCz11 20 36828696
KASP Assay ID:
554-2886.1 (used for ordering genotyping assays)
KASP Sequence:
GTGTGGTGTGCAACAGTGAACTCTGCCCCTATGGCAACTGGATGCACCTG[C/T]AGTGCTTTTATGAGTGGGAGAGCAGCATCCTGGTGCAGTTCAACTGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18612
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062935 Nonsense 225 523 2 4
Genomic Location (Zv9):
Chromosome 20 (position 36853699)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36926212
GRCz11 20 36829091
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCTCCAGTCAGGAGCTTTCAYGCAGACAATCAGCAGATTGGCAGAACTG[T/A]CAGGAGCGATGTCACGCTGGTCCTCTCAATGCAGTCRGTGGGATGTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3059
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062935 Nonsense 499 523 4 4
Genomic Location (Zv9):
Chromosome 20 (position 36863260)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36935773
GRCz11 20 36838652
KASP Assay ID:
554-2687.1 (used for ordering genotyping assays)
KASP Sequence:
TAGATGTACGTGTGGGTATGCAGTATTTTTCCGAGTACAGCAATGTACAG[C/T]AGTGTCCTCACTGCGGCAATCTGGACTATCACTTTGTAAAGCCATTCTCC
Associated Phenotype:
Not determined