Busch Lab

ZMP

ltk

Ensembl ID:
ENSDARG00000042861
ZFIN ID:
ZDB-GENE-030616-115
Description:
leukocyte tyrosine kinase receptor [Source:RefSeq peptide;Acc:NP_001006661]
Human Orthologue:
ALK
Human Description:
anaplastic lymphoma receptor tyrosine kinase [Source:HGNC Symbol;Acc:427]
Mouse Orthologue:
Alk
Mouse Description:
anaplastic lymphoma kinase Gene [Source:MGI Symbol;Acc:MGI:103305]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa9910 Nonsense Available for shipment Available now
sa42962 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1500 Nonsense Available for shipment Available now
sa45612 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9910
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061547 Nonsense 232 1530 6 28
ENSDART00000062907 Nonsense 232 1504 6 29
ENSDART00000111621 Nonsense 232 1504 6 29
Genomic Location (Zv9):
Chromosome 17 (position 31505168)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31429095
GRCz11 17 31446058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGTGTGGWTTTCTGCAGGTGATGATTATGTGGATTTGGGTTCCGACTG[T/A]GAGAAATACTCATCTCTTCAATGTCATTCTGGAGGCTGCATTGAGAAACA
Long Flanking Sequence:
CATTCGATTCACTGGAGCTGAAGAACTGTGTCATGGGTAACAGCTTTTTATCTGTTCTCAAATAATACCTAACTGTGTCTTATGATTATTACCTTTTACTGTAAAAACATTCTGTGTAATTTTTGGTTTATTTTTCCATTTATTTAATTTTACCATCAAAAGTTGACCGATTAGAGATTATATATTCAGTATATTATACATAATATGTATTATATTTACTGTGGTTTTAGCGAAAGTCTTTAAAAGTTTGGTTCATGTTATTGAATTTGCATTGAGAAGTATTGGAATGTGGTTTGGGATTCATGCAACTCTGGATGAAAATAAATGTTGTGACTATACATATAGAAACTATTTCATGGCTGTTGCATGCCAAAATTAAAGCTTAAGGTGGTCCAATGTAATATTAAAGTAAGCAAATTTTATTTTTGGACAGGCAGTGTATGTAATGGTTTTGTGTGGATTTCTGCAGGTGATGATTATGTGGATTTGGGTTCCGACTG[T/A]GAGAAATACTCATCTCTTCAATGTCATTCTGGAGGCTGCATTGAGAAACAAAGAGTGTGTGATTTCCACACTGACTGCCCAGAAGGGGAGGACGAGGGCTTAATATGCAGTGAGTGAAATTCAATATTGTAGATGTTTTATAAACCATGAAGATGTGTAATTTTTGTTTATCAGTCTGTCATCAATTGTGAACACAGCTTTCAAAATCTGATGCCTTTTCAGTTTTATGCAATTACTGTTGCACACATCAGATGATGGAGCTCTTAGGTCTTAAAGAAAGTCTGTCATCTTTTTGTTGTTTTAAATGTAAAGAACGGGCTGCATTCCATCAATCCATTATTTTAATTTATGATAATCGAAACATTTCTTTGAAAGGTGGCCTTGGAGCTATAAATCCTTGTTAGATTTGCGAGATCATTCCTGCCAGTTTGCATTTGGTTGAAAGCGCTCAATTAAAGTATGAACAGCAGTGTGACAGGGCTAAATAAGAGGGTGCGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42962
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061547 Essential Splice Site 406 1530 9 28
ENSDART00000062907 Essential Splice Site 406 1504 9 29
ENSDART00000111621 Essential Splice Site 406 1504 9 29
Genomic Location (Zv9):
Chromosome 17 (position 31497124)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31421051
GRCz11 17 31438014
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGATGCCTGGCAAGAGATCACTCTGCCGATCACAGAGATTTTAAATGG[G/A]TGAGATAATGGGATGAATGCATCAATGTTGACCGTCTTGGCTTTGTGCTG
Long Flanking Sequence:
AGAACAAGATTTCGCTTTTCATCAATTTAATGTGCCCTTGCAGAATAAAAGTATTGTTTCCTTCATTTTCCTGTACATAAATGGTCTTTCACTTAAAAGTGTGGTGTTCCTACAAGTTAGCCACAATGTTTGGTTTTAGGTTTTATGAGCCTGTTTCAAGTTAATTGTCCATAAAAAAAACAAGGACACATCTGTACAGCATATCTTCAAACAGCTTACGCTGAATAAACGTACATGCAGCCAGTTTAAATTTTACACTTGATTTTCCATGAATAAGGTGTTTTTTTTCTGAGACGTCTGGTCTTGTAGTTGCTGAAGTGTTGAGGTTTTTCTGCGCAGTTGCAGTTTTCTCTCTACCGGTATGGGGATTTCAATGGAACAGTGCTTTTGTCTGTGGTGGAGAGCGGAGCCTCAGCACCAGCACTGATTTGGGAGAGATCCGGACACTGGAAAGATGCCTGGCAAGAGATCACTCTGCCGATCACAGAGATTTTAAATGG[G/A]TGAGATAATGGGATGAATGCATCAATGTTGACCGTCTTGGCTTTGTGCTGAAGCCAAAGAGACTTTCAGTGGCATAGTCGTCATCTAATAATTTCATTTCGAATCATAATCTACTGATTTCATTGAAAAAACAACTATCAACTCAAGGTGAATGATGTCACTAACACCCCTGCTGTGCATTATTTTCCAATAATTTAACAAACCCGAGTCAACTTACCCTATACTACAGCCACCACACCTAAAGACAATAATAATGTTATTTATTTTAAGATAGCTGCCAGGTTTATGCTCTTAACCACTCTTACATATTGCACATCTCATCCAGAGCCTCCTTTTTTTTGTTTATATACAGTCAAGCCTGAAATTATTCATACTTCTTGTGCAATAATATTTTCAGGCTTGACTTTAATTTAATTTTAACTTTAATTAAATGAAAAATCACACTACTGGTCAAAAGTTTGGGGTCGTTTTTTAAAAATGTTTTTTAATTTTAAATAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1500
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061547 Nonsense 898 1530 19 28
ENSDART00000062907 Nonsense 872 1504 20 29
ENSDART00000111621 Nonsense 872 1504 20 29
Genomic Location (Zv9):
Chromosome 17 (position 31469392)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31393319
GRCz11 17 31410282
KASP Assay ID:
554-1425.1 (used for ordering genotyping assays)
KASP Sequence:
AGAAGAACCACCTGCATGCGGTCAGGATTCGACTGCAGAGTCCAGAGTAC[A/T]AGCTTAGCAAAATTCGCTCGTCCACCATCATGACCGACTACAACCCCAAC
Long Flanking Sequence:
CAAAATATATTGCTCTTGGTTTGAATAATTTGACAATTGCTTTAAATATACATTATATAATCTTTATATAATCTGAATTTAATTTGAATTTAAAATTTTTGCATCTCAATTTTCACTAAGGGTACCCTTAACCGTAAAGGGTTTGTTAGCTTAAGGGTTTCATGCAACCAGGCCCAGAGCTTGAGTCCTCATCCGAGTGGCTTTAAAATGCACAATTTGATAGAATTCCAAGGGGAGAAATAAGTGCACTTGGTTGTTCTGTATCTCTTAGAAAATTACCATCATGAAAGCCTATATTGACAATCTTATCTACATCGCACTCTGAGATGAACAATTATGCAAATTGAGGCAGTGGATTTATGGCTGAAGAAAACTTCTTAAAAGCATGATGACTTTGGCTGATTCTTGGTGTGTGTGTGTGTGTTTGGCTTTTTGCAGTATATTATCGTAAGAAGAACCACCTGCATGCGGTCAGGATTCGACTGCAGAGTCCAGAGTAC[A/T]AGCTTAGCAAAATTCGCTCGTCCACCATCATGACCGACTACAACCCCAACTATGGTTATTTTGGAAAGGCAGCCTCTCTGAGTGAACTGAAGGAAGTGCCGCGTAAAAACATCACCCTCCTCAGGTATATGCTGCCTTGGACATAGCTTGCAGATACCCACCAAGCAACTTTGCATTTAATAGACATTTAATAGACATCTAGCATGGATGTCTTGGCTAAAATAAGGCTAAACTTGGTATTTGGTCAGTAAAAATCTAATAGATGTCTTAAAATAGCCCACATTTAGTCTAATCATCAGACAGATTAGACTGAATTCACGTTTAGTTGTATATTCATGTGTATTTGATTTGACTATTCTAGTTTTGGACTATTCTTTTGCATTTATTAGGTTTACACTGCATGAATGCAACCTTGTTTTAGCCAAGATGTCTATGTTTAGATGTTTAGTGAATTGGGTAAACAAATTTGGCTGTAGTGCATCAGTGTTTGTGTGTGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45612
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061547 Nonsense 1078 1530 24 28
ENSDART00000062907 Nonsense 1052 1504 25 29
ENSDART00000111621 Nonsense 1052 1504 25 29
Genomic Location (Zv9):
Chromosome 17 (position 31463660)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31387587
GRCz11 17 31404550
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTGTGTGTTTTTCAGGGACATCGCCGCTCGCAACTGCCTTTTGACTTG[T/A]CCTGGTCCAGACAGAGTGGCTAAAATTGGAGATTTCGGGATGGCCCGAGA
Long Flanking Sequence:
ACACTTTAATACAATTTCAAAACAATATTTTTACACGTTTGTACATGAACTTCTGCATGGAATAACAGCATTTACAGCCATACAATGGCTTTAAGCCCCATTATACACATACATTTCAAAAGATAAGCACATTTTCAAACACCAGATGATAGTGTTACATACTGTATGTATTAAATCTTGTCTTGTCTTCCCCCAGAACCATTCGTCTTCTCTAAGCATGCTGGAGCTTCTTCATATGGCCAGAGACATCGCTCTTGGCTGTCGCTACCTTGAAGAAAACCACTTCATCCACAGGTGATTGTCCTAACTGATCTTTGCCCTAAAGTTGCCTTCGTTGTCTCAATGAGTGGACAGGACACTACTCTTCAGTGAAACAATAGACATCAATCATTAACTCCCTGCAGCTCTTGACCTTTATGTCTTGCACACATACAATAAGTGCGTATGTGTCTGTGTGTGTTTTTCAGGGACATCGCCGCTCGCAACTGCCTTTTGACTTG[T/A]CCTGGTCCAGACAGAGTGGCTAAAATTGGAGATTTCGGGATGGCCCGAGATATTTACAGGTGCTTGTTATGTTACATGCTTATTTTTTATTGTAATGAGCACGTGCATTGAGTTTCATACATTGACAAATACTTTTTAGGGCCAGTTACTATAGGAAGGGTGGCCGTGCCATGCTGCCAGTCAAATGGATGCCACCTGAAGCTTTCCTAGAGGGCATTTTTACATGCAAGACTGACACCTGGTAATAAACTTTAATTACTAAATTTAAATTATTAATTTAACTTAAACTAAAATGTGTAGAAATCACTGTATATGCATTCAATTTCTTAAATCATCTCTGCATTTTGTTAAATGCGATATTATTAGTAGATCAGTAGTACTGCTTTTATGTGAGGCCAGGCTTTGTGGTCATTGCATGCGATTTGTCTCCATCTGCAGGTCATTCGGGGTACTGCTGTGGGAGATTTTCTCTCTTGGGTACATGCCTTATCCCTGCAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28884
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061547 Essential Splice Site 1132 1530 25 28
ENSDART00000062907 Essential Splice Site 1106 1504 26 29
ENSDART00000111621 Essential Splice Site 1106 1504 26 29
Genomic Location (Zv9):
Chromosome 17 (position 31463417)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31387344
GRCz11 17 31404307
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCTGAAGCTTTCCTAGAGGGCATTTTTACATGCAAGACTGACACCTGG[T/A]AATAAACTTTAATTACTAAATTTAAATTATTAATTTAACTTAAACTAAAA
Long Flanking Sequence:
AGACATCGCTCTTGGCTGTCGCTACCTTGAAGAAAACCACTTCATCCACAGGTGATTGTCCTAACTGATCTTTGCCCTAAAGTTGCCTTCGTTGTCTCAATGAGTGGACAGGACACTACTCTTCAGTGAAACAATAGACATCAATCATTAACTCCCTGCAGCTCTTGACCTTTATGTCTTGCACACATACAATAAGTGCGTATGTGTCTGTGTGTGTTTTTCAGGGACATCGCCGCTCGCAACTGCCTTTTGACTTGTCCTGGTCCAGACAGAGTGGCTAAAATTGGAGATTTCGGGATGGCCCGAGATATTTACAGGTGCTTGTTATGTTACATGCTTATTTTTTATTGTAATGAGCACGTGCATTGAGTTTCATACATTGACAAATACTTTTTAGGGCCAGTTACTATAGGAAGGGTGGCCGTGCCATGCTGCCAGTCAAATGGATGCCACCTGAAGCTTTCCTAGAGGGCATTTTTACATGCAAGACTGACACCTGG[T/A]AATAAACTTTAATTACTAAATTTAAATTATTAATTTAACTTAAACTAAAATGTGTAGAAATCACTGTATATGCATTCAATTTCTTAAATCATCTCTGCATTTTGTTAAATGCGATATTATTAGTAGATCAGTAGTACTGCTTTTATGTGAGGCCAGGCTTTGTGGTCATTGCATGCGATTTGTCTCCATCTGCAGGTCATTCGGGGTACTGCTGTGGGAGATTTTCTCTCTTGGGTACATGCCTTATCCCTGCAAAACTAACCAGGAAGTGCTGGAGTTTGTAACTGGTGGAGGTCGCATGGATCCACCTAAGAGCTGCCCTGGGCCTGTGTAAGTATATAGAGTGCTGCTGCAGTGAATAATTAGCCACAAGTTTTCTTGAGTTTTTCCTATGGGTTGTAATAATGGAGCTTTTCATTTCAAAGATAAAAATACTTGGCTGTTCTGTTGTTCAATGTAAAGTACCCACGCTTCCAATGCTAAAATAATTGTAGTATTTT
Associated Phenotype:
Not determined