Busch Lab

ZMP

ivd

Ensembl ID:
ENSDARG00000042853
ZFIN ID:
ZDB-GENE-030616-262
Description:
isovaleryl-CoA dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_958899]
Human Orthologue:
IVD
Human Description:
isovaleryl-CoA dehydrogenase [Source:HGNC Symbol;Acc:6186]
Mouse Orthologue:
Ivd
Mouse Description:
isovaleryl coenzyme A dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:1929242]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6485 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23118 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6485
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062894 Essential Splice Site 93 418 None 12
ENSDART00000129363 Essential Splice Site 100 425 None 13
ENSDART00000134686 Essential Splice Site 100 156 None 5

The following transcripts of ENSDARG00000042853 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 31414930)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31338857
GRCz11 17 31355820
KASP Assay ID:
554-4515.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTGGAAGGAGATGGGTGACCTTGGACTRCTTGGAGTTACTGCACCAGG[T/C]TGGATCATATACGCTGTTTCATAAAACATAACTATTGTTGATGACTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23118
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062894 Nonsense 331 418 10 12
ENSDART00000129363 Nonsense 338 425 11 13
ENSDART00000134686 None None 156 None 5

The following transcripts of ENSDARG00000042853 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 31409088)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31333015
GRCz11 17 31349978
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGCTGATGCAAGGAAAAATGGCTGACATGTACACACGCCTTAGTTCCTG[T/A]CGACAGTATTTATACAACGTTGCTCGTGCTTGTGACAAAGGCCATTTCAG
Associated Phenotype:
Not determined