Busch Lab

ZMP

slc16a4

Ensembl ID:
ENSDARG00000042807
ZFIN ID:
ZDB-GENE-070112-602
Description:
solute carrier family 16, member 4 [Source:RefSeq peptide;Acc:NP_001074068]
Human Orthologue:
SLC16A4
Human Description:
solute carrier family 16, member 4 (monocarboxylic acid transporter 5) [Source:HGNC Symbol;Acc:10925
Mouse Orthologue:
Slc16a4
Mouse Description:
solute carrier family 16 (monocarboxylic acid transporters), member 4 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa9884 Essential Splice Site Available for shipment Available now
sa8810 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21290 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3651
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078656 Nonsense 78 558 3 9
Genomic Location (Zv9):
Chromosome 8 (position 25609572)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24737490
GRCz11 8 24756629
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAGACCTTTGGGATCTTYTTCGTGGCTCTGCAGGATGAATTTGGAGGGT[C/A]ATCCGAGAGCATCAGCTGGATTGGATCCATCATGTCCAGCCTCAGGCTTT
Long Flanking Sequence:
TTTTTCAGGAACGCATCCAGGTTTTCAAATAGTTACATCTCAGCCATATCTTAATAAAGTATACGTTAATAGAAACCTTATTAATTTATGATCTATAAATCTCAATTTAAAAAAAACTCACACTTATGACTGGTTTTGTGCACCAGGATCACATTGTTTAATGATAAACGAATGCTGTGATGTTTCAGTGATGGCAAGACTGCTAAAACCCCATGCTCTGAGCTAAAAGCCAAGGTCATGAAGAAGGAAAAGAAGAAGGTTGTGTATCGGGAGCCACCAGATGGCGGGTGGGGTTGGATGGTGGTTCTGCATTGTTTCCTGGTATGTCGTGAGTCCTGCGGTTATAGACTTTGATTTAAAGCTTGTTTGCTGTGATACAACTCCATCGATCTAAACTCAACTGAACTCTGCCGTGTCTTTTCAGGTGAACGTGCTGGTTATGGGTACACTGAAGACCTTTGGGATCTTTTTCGTGGCTCTGCAGGATGAATTTGGAGGGT[C/A]ATCCGAGAGCATCAGCTGGATTGGATCCATCATGTCCAGCCTCAGGCTTTCCGGAGGTATGGTCAATATAAACAGCCATCTTTGATCAGCATGATTGGTTGTGACCTCAATTTTGTTTGTAACCCTTAGGTCCATTGGCTTCAGTGGCCTGTGCAAAGCTGGGGAATAGGGTTACCTCCATAGTGGGGGCGCTTTTTGTTAGTGCTGGCTTTCTGTTCAGCATATTTGCCACCAGCGTGACCTACCTTTACATTAGCATGGGGTTAGTTGTTGGTGAGTATTTGATTTTAAATGTTGATGCTAAGATTATTATGCAAAAAGTCATTCACAAACTTGATTTTTCCAGGACTCGGGTTTGCTCTTCTTTATCAGGCCACATCTGTTGTAATAGTGACCTATTTCCGAAAGAGGCTGGCAACGGCATATTCCATTGGACGCTCTGGCATGGGTCTGACCTTTGCCCTCGCTCCATTCACTCAGCTACTTTTGGATCAGTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9884
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078656 Essential Splice Site 388 558 6 9
Genomic Location (Zv9):
Chromosome 8 (position 25613089)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24741007
GRCz11 8 24760146
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAATCTGGGAATCGACCCCATGGATGCTTCCTTCATCATCTCTGTGGCTG[G/A]TGAGTCTTATTATGGAACCCTAGAGTCATGTTTTTGCACCGTCATCCCTT
Long Flanking Sequence:
CATTAGACATCCAGCTTCACCCATTTCAAACTCCACCATTCATAAGACTGAGAAAGATCCTCTCAAAAACAATATGAACGGCAACACGCCAGTAGCCAATGGCACTTCCAAATCAGACAGCTCACCCCCCATTCACAAAGACACACTTATAATAAAAAACCCCGTTCACGAGCAGAACTCTCTCCCTCACCTGGATCTCAAAAAACCCACCCAGAACGGAGTGAACGGAACGGACAGCAGCCAAACTAAAACTTCCCCCGAGATGAATGGGGTTTCTCCTGTGGATTCATTACTTGAGAACGGCAGAACAGAAAATGTGCCTGAAAACTCCCCAAAAGTGCTGGACTTCTCTCTGTTGAAGAACCCTTTCTTTTGCATCTACACCTGGTCGCTGGTCTTCAGTCAGCTGGCCTATTTCATCCCTTATTTTCACTTGTCTGCGAGAGCCCGGAATCTGGGAATCGACCCCATGGATGCTTCCTTCATCATCTCTGTGGCTG[G/A]TGAGTCTTATTATGGAACCCTAGAGTCATGTTTTTGCACCGTCATCCCTTTGAAATATTAAGTGCTTTTAGCAGAATTCATCTTGCATTAGTATGGAAATCATTTGTGATTACATTTAACAAGTAACCTATTTTGAGCGTGCTGTACTCAGACTCAGCATGTTTGTTAGTGTTGTCCTCTGTCTGCAAGCGTACACTAGTAATGCGTAACAGTAGAGGAAATCAATAAGCTGTAAGCCCTGCTGAGCTATGCTGTGGAAAATGGAAAGACGAAAGGCAGCATAATGACAGTCCTAGTGGACAGTCTGAAATAGATGCTGTTTTTTTCTGGTTTCATCAATGCTGTTTTCCAGGAAAGCCATTATGTTGTACCTAAGAGATGCACTACGGCCGTTGTGCTTCACAGCAAGATGTGATCTAAGATGGGCTTTAAAGGGTGGATGCAAAAACGCAGCCAAGTTCGCATTAATTATTTGTGGGCATTTTAAAATCTGCAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8810
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078656 Essential Splice Site 459 558 7 9
Genomic Location (Zv9):
Chromosome 8 (position 25620010)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24747928
GRCz11 8 24767067
KASP Assay ID:
2260-0584.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTTGCCATCTTCTGTGGAGGGTACATGGCKCTCCTGCTTCCTGTACTG[G/A]TGAGTACTGAACATGAACCATTTTCACAATAAAGAAAATTSWTTCAGAGA
Long Flanking Sequence:
TGCAAACATCTACATTGGTTTTATCAGATGAATATTAAACTGCTGTTTTCTCACTGTTGAAGTAGTTAGATATGGTTATTTTGTGATGGAGAAGTGCAAGCATTTGTATATTCATCTAAATGCCACTCTTCCTGCTAATATGAGGAAGAGGCACTAATTATTGTGCTCATTTATAAAGATGTACTCATTCATGAATGTTTTGCTAGTTGTGCTCAATCTACTACAGTTCTGCAACACTGTATACACTCGGTGCTCAGTTTTCAGTTCAACAGCTTTTCTCTGTGACAGGTATAACAGAGACGGTGGCTCAGCTTGCATCTGGCTGGGTGACGGACAGGAATCTGGTGCATAAATATCATTATCATAAAGCTTACCTGATTCTGTGCGGTGTGGTCAACCTTCTGTCTCCTCTGGCCACCTCGTACATCTTGCTCATGGTTTACGCTGTCTTTTTTGCCATCTTCTGTGGAGGGTACATGGCTCTCCTGCTTCCTGTACTG[G/A]TGAGTACTGAACATGAACCATTTTCACAATAAAGAAAATTCTTTCAGAGATCATGAAGAGTTAGAATATACAGATTCAGCACCCGTCAAACAGGATGCCAGTCAGGACCAAATGATGTGCTATAAAAAGTGATTAGTTGCTTTGCTTAAAAAAGTGAGTAAAACTTTCCTTTTAAAGAATCAAGTTGACTTAACTTAAAAAGCGAGTTAAGCGAGAGTAAACCCATTACTTTAAAAGCATCAAGTTGACTTCACTTAAAAAAGTGAGTAAATGTAAATGTGCACTTACTGCCTTTAAAGCATTGCCTTAACTTAAAGGCAAGACTTAAGACTAAACTTAAAGTGAGTAAATCCATTACTTTAAAAGTATCAAGTTGACTTCACTTAAAAAAGTGAGTAAACCCATTGCCTTTAAAGCATCAAGTTGACTTCACTTAAAAAAGTGAGTAAACCTATTGCCTTTAAAGCATCAAGTTGACCTAACTTAAAAAAGTGAGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21290
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078656 Essential Splice Site 491 558 9 9
Genomic Location (Zv9):
Chromosome 8 (position 25631087)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24759005
GRCz11 8 24778144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAATTTGGCATCACTTTAATATGTCTAACGTTTTGCATTATGTCCCAAA[G/T]GCTTCCTATACGACTACACTCAGACGTACGACTGCTCCTTCTACCTGGCA
Long Flanking Sequence:
TGTGGATGTTTCCTAGAGATGAGTTGCGGCTGGAAGGGCATCCGCTGCGTAAAAATGTGCTGGATAAGTTGCCGGTTCATTTCACTGTGGCGACCCCGGATTAATAAAGGGACTAAGCTGAGAAGAAAATTAATGAAAATCAGTCATGATCATATTTTATTTTGGTAAAATAAGCATAATCCAGAGGCCTTTGCCTTTAAAATAAGCCACTTCTGATACCAAATGATCAACTAGAAGTCAAGTTATTTTTTTTTTTTCTAAATCTTGGATAGGCAACAAGTCTTTAGTCAGGTAGTGTATATAAACCAATAGCAAACAACAATAACAATCCAATCCCGTTCTGCATCTGTTCCTCATTGAAGAGCCTGTTCACTCAGATGTGTCAAAATATCTGTTCCAATTATCTAGATAATTATCTTCTCTATTTCATGACAGATAGAGCAATTTTTCTCAATTTGGCATCACTTTAATATGTCTAACGTTTTGCATTATGTCCCAAA[G/T]GCTTCCTATACGACTACACTCAGACGTACGACTGCTCCTTCTACCTGGCAGGTGTGTGTTACCTCTTATCATCGATTTCTCTGTTCCTCGAGCCTCTGGCGAGGCGCTGGCAGGCCCGAAAGGAACGGCTTGAGACGCTAAACCAGGAGTTGATGTGGAGTAATGGTTGTTTCTGTCCGGCACCTCAGAGGAACGGTGTTGTATAATAAAGGAATAAACTCACAACCGTTTCACCTTTCATCACGTCATGTGGTTCAGTCTCGGAAGAGGAGCTGACCTGAACATTTGGCGGGACCACACTACGGCAAGCAAATCAGTGTTCATTTGAATTCAGAGACCAATAAATGCTTGAGGACACCACAATGCAAACTATTTCGTTAGTGGACGAGGGAGAATGGATTTTGTTGATTTTAATGAACAAACATGTGCTTCCCTCACCCTCGCACAACAAATTTATGTTTTGTCGCACCATTTCTAAGCAAATTACGACAGTGGATTAT
Associated Phenotype:
Not determined