Busch Lab

ZMP

tpp1

Ensembl ID:
ENSDARG00000042793
ZFIN ID:
ZDB-GENE-030131-6654
Description:
tripeptidyl-peptidase 1 [Source:RefSeq peptide;Acc:NP_001122270]
Human Orthologue:
TPP1
Human Description:
tripeptidyl peptidase I [Source:HGNC Symbol;Acc:2073]
Mouse Orthologue:
Tpp1
Mouse Description:
tripeptidyl peptidase I Gene [Source:MGI Symbol;Acc:MGI:1336194]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa11 Nonsense Confirmed mutation in F2 line Not yet available
sa8389 Nonsense Mutation detected in F1 DNA Not yet available
sa2895 Essential Splice Site F2 line generated Not yet available
sa6483 Nonsense Mutation detected in F1 DNA Not yet available
hu3587 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

Allele Name:
sa11
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062806 Nonsense 40 557 3 13
Genomic Location (Zv9):
Chromosome 17 (position 30905096)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30829023
GRCz11 17 30845986
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTAGTGTACCTGGGGACTGGACATTTCTTGGACGGGTTGGACCAT[T/A]GGAAGAAGTTGAACTAACGTTTGCGCTGAAGCAGCAGAATGTTAGCAAGA
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Control on top; Mutant below; 48 hpf
Control on top; Mutant below; 48 hpf
Stage Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
whole organism
ZFA:0001094
decreased size
PATO:0000587
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa8389
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062806 Nonsense 98 557 4 13
Genomic Location (Zv9):
Chromosome 17 (position 30905371)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30829298
GRCz11 17 30846261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGCTCTTTCCAGACCTTCTCCGCTGACTGAAAAAGTGSTAGAGAATTG[G/A]CTTCGGAGTCATGGGGTCATGGACTGTCACACTATTAWAACACGGGAYTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2895
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062806 Essential Splice Site 377 557 9 13
Genomic Location (Zv9):
Chromosome 17 (position 30908710)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30832637
GRCz11 17 30849600
KASP Assay ID:
554-2511.1 (used for ordering genotyping assays)
KASP Sequence:
ACCTGACCAAAGAAAGAAATACCTTTAGGCCAAGTTTTCCTGCTTCCAGG[T/C]GGATATTGCTTTCTAAATAATCTGTATAATACTGATRAACTGATTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6483
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062806 Nonsense 396 557 10 13
Genomic Location (Zv9):
Chromosome 17 (position 30908839)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30832766
GRCz11 17 30849729
KASP Assay ID:
554-5209.1 (used for ordering genotyping assays)
KASP Sequence:
GTGACCACTGTGGGTGGGACTTCTTTTCAAAACCCCTTCAAACTCAGCTA[T/A]GAGGTCACAGATTACATCAGCGGAGGCRGCTTCAGTAATGTGTTTCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3587
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062806 Nonsense 444 557 11 13
Genomic Location (Zv9):
Chromosome 17 (position 30911241)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30835168
GRCz11 17 30852131
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCAGTCTCTTCCTCCTCAGACATATTTTAACACCACTGGAAGAGCTTA[T/A]CCAGACCTAGCGGCGCTTTCTGACAACTACTGGGTCGTCTCCAACCGTGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461