Busch Lab

ZMP

apob

Ensembl ID:
ENSDARG00000042780
ZFIN ID:
ZDB-GENE-070702-4
Human Orthologue:
APOB
Human Description:
apolipoprotein B (including Ag(x) antigen) [Source:HGNC Symbol;Acc:603]
Mouse Orthologue:
Apob
Mouse Description:
apolipoprotein B Gene [Source:MGI Symbol;Acc:MGI:88052]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa42959 Nonsense Mutation detected in F1 DNA Not yet available
sa36449 Nonsense Mutation detected in F1 DNA Not yet available
sa36450 Nonsense Mutation detected in F1 DNA Not yet available
sa13626 Nonsense Available for shipment Available now
sa13822 Nonsense Available for shipment Available now
sa8678 Nonsense Mutation detected in F1 DNA Not yet available
sa11961 Nonsense Available for shipment Available now
sa6482 Nonsense Mutation detected in F1 DNA Not yet available
sa36451 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42959
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 447 4418 10 29
Genomic Location (Zv9):
Chromosome 17 (position 30768024)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30691951
GRCz11 17 30708914
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATGGAATATTAACATATTAACCTATATTTTGCAGGCTTCCTCAAGAT[C/T]AAGCAACATCCACGCCTGAAGTGAAAGAAGTAGCTAAATTCATGGAGTTC
Long Flanking Sequence:
ACAATGAAAGAGTTGATTACGCTTAGCAGCTCAGGAAAGAGTCAACAGAGAGCCAGCCTCTTCCACAAACTAGTATCTGAAGTCCGTGGTTTGAAAAATGAGACGCTGTCTGGAGCTGCCGATGAGATGATGAAGTTCTCAGAGTGGCTCACATGGCAGACACTCTTTCAGTGTGGGACTGATGAATGTACCAGCGCCATCATGCAGATCCTCAGGACATTCGATGAGGCAGACAGAGAGGTGGATGCTATAGTTTATGCTTTGAGTCTTTTACCTCAGAGCAGCCCCCAGAGGCTTAGAGATATGCTGAGTATGGCCCAAAGCAAGCCAAGCAAACCCATCATGTATGCTCTGGCCAACACAGTGAAACAGTAAGTGCTTTTAATGTTTGTTCATGTTTACTCCATTTGTTTCTGAGTTATTATCATAGGTTTTGTGATTTCCTTTTTAAAAATGGAATATTAACATATTAACCTATATTTTGCAGGCTTCCTCAAGAT[C/T]AAGCAACATCCACGCCTGAAGTGAAAGAAGTAGCTAAATTCATGGAGTTCATGTTAGGCGATTGTTCTGGAGATGAAGACAGTACTTTCCTAACATTAAGGGTAAATTTGTCAGTCCATCCTGTACATAAATACAAATTTTCACAATTTATTCTGTATTAAACAATGTATTTGTTGTACAGGTCATTGGTGTCATGGGAAAATACATGGAGGGATTCCCATCTCTGAAGTCTTCTGTCCTAAATTGCATGAAACAGGCATATGCCCCTCTGCCTGTGCAAAAAGCAGCTATCCAGGCTTTTAGACTCATGGAAATGGATTCAGATGTAAATAAATCAACTTTTTAAAAAGACATTCAATTGCCTTCATTTTAATCTAGCAATGCTTAAAATAAAGTGACCAAATTGCTTAAATGTGAGCTGGGGATTTTCTGCATTCTAGTGGTCAAAATATCAATATGATTTATGGTTTCTTTACATTTTTGTACAGTATATGTATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36449
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 541 4418 12 29
Genomic Location (Zv9):
Chromosome 17 (position 30768769)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30692696
GRCz11 17 30709659
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTTGTTTCTAGGTGAGAAGTGCTCTGATTCAACAATATCAGAATGTC[G/T]AAGCACCTGCCCAAAAACGTATTGCAGCATATCTGATGCTTATGAGAAAC
Long Flanking Sequence:
TGCATGAAACAGGCATATGCCCCTCTGCCTGTGCAAAAAGCAGCTATCCAGGCTTTTAGACTCATGGAAATGGATTCAGATGTAAATAAATCAACTTTTTAAAAAGACATTCAATTGCCTTCATTTTAATCTAGCAATGCTTAAAATAAAGTGACCAAATTGCTTAAATGTGAGCTGGGGATTTTCTGCATTCTAGTGGTCAAAATATCAATATGATTTATGGTTTCTTTACATTTTTGTACAGTATATGTATTGTATGCTATTATTTTTAAGCAAATGAAAACAGTCAGACAGGACAAAAAAAATGGGACTGTCCACAGAAAATAGGAGTATCTTAAATTATGTTATTGTGCTATCATTGGTCACCCAAATAAAATTAGTGCTTGAATGATTTTGAATTAATCAAAAACAGACTAACTGGTTTTCACTTTAACTCATGTGATATTGTGATTTCTTGTTTCTAGGTGAGAAGTGCTCTGATTCAACAATATCAGAATGTC[G/T]AAGCACCTGCCCAAAAACGTATTGCAGCATATCTGATGCTTATGAGAAACCCTGAGGTAGCAGAGAATGTGCTGAGGACACTTAAGAGTGAGCAAAATGAGCAGGTTAAGAGCTTTGTCTCTTCCCATATAGCCAACATACTGGAATCAGAAAATCCTAACCTGAGCATGTACGTACAATACTATTCAAACACTGTATATTATGTGTTTTATTAAGGCCTTCTAATACGAAATGATCTGTCTTGATGTTTTTTATTTAAAGTATAAATAGAACATATAGTGTGGATGTTGTTCAGTGGTTTTTTAAATGGGTTTTGGAAAATGCGAGCGGAGAAGAACCCTGGGGGTCTAAGGGGGTTTTGAAGTCCTTAGAATAATGTGAAAAACTCTTCTTACTAGATTTAACATTACACATAGCACATTATTAGTATTTTCAACAGTGAAATATTAGCAACATATATGTGTGATTGTTTTAGTTAAAAAAAATGGATATATCTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36450
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 601 4418 13 29
Genomic Location (Zv9):
Chromosome 17 (position 30769616)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30693543
GRCz11 17 30710506
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTATTGCATTCCTAATTTTGTTGTATATGTTTTTAGAGCAAAGGACTA[C/A]ATTCTTAAAGCTGTACAAGGAGATGTGAGCTTTCCCCCTATGGACTTCAC
Long Flanking Sequence:
TCTAAGGGGGTTTTGAAGTCCTTAGAATAATGTGAAAAACTCTTCTTACTAGATTTAACATTACACATAGCACATTATTAGTATTTTCAACAGTGAAATATTAGCAACATATATGTGTGATTGTTTTAGTTAAAAAAAATGGATATATCTTGAAATAAATGTAGGCATAACAAAATAATGTCTAATGTACAGAATAAATTTAATAATGATACAAATATGAGTCAACTGACTATTGCAAACCTTGGTAAATTGCATTGCATGATTTATTGAAATGCTCTCCACCCATAAATATTGCATCTGATTCCCTTGAAGCCATAAAAATAACACGCCTTATTGTCACAAAGTTTAGTTAGTAAATCCAGAAAGTAGTTTTTAATTCCAAAACTTTTGTTCTGGTGTAAGCTGTCGATGAATATGGCTCACAATCTCTAAAACTGGTTGACAAAGAATATGTATTGCATTCCTAATTTTGTTGTATATGTTTTTAGAGCAAAGGACTA[C/A]ATTCTTAAAGCTGTACAAGGAGATGTGAGCTTTCCCCCTATGGACTTCACAAAGCTCTCCCGTAACTACAAAACTGAAGTTCCACTGGTTGGCTCTGTAGAAAGCAATGTCATTTTTGACTCTGCCAATTACATGCCCAGAGAAGTCATGTTAGCCACCACACTTGACAATTTCAATCCAGAAATACTGGAGGTACTCTACAAGTTGATCAAAAAAGACATACTTTATGCGTCAGTATTCTATTGTTGTTATGTTTTAGGTATCGTTTATGAATGCATGTGTTCACTTTTTTTCAGATTGGTCTTGAAGGTGAAGGCCTTGAGCCAGTCATTGAAGTTCTCTTTGGTGAAAATGGGTTCTTCCCTGATACTATCTCAAAAGCAATGTACTGGGTTAATGACAAAATTCCACATCCTGTCAAACGGGTTCTGGAAAAATGGATTTCCCCACTAAATGGTGAAAGGATGAAAAGACAGGTAAGAACATAAAGTAACTTTAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7832
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 1158 4418 22 29
Genomic Location (Zv9):
Chromosome 17 (position 30775220)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30699147
GRCz11 17 30716110
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTGAGATTTGAACTATTTTKACTTTGCAGATAATAACAAGGTTGAAATT[G/T]AAATGAAGTCAGACATAAACTCTGAGGTTGAGAAACTTTTTCCAAATATG
Long Flanking Sequence:
CTAAAGGGAAGAAGATGCGTGGGATCACAATTGATGTTACTAATCGAGACATCCCACAGCTTTCCATAGTTGGACACGCCAGGTAAAGTATAAACAGTTATTTATTTTTAACACAGTAAATGCTCAATAGTGGGAAAGGAAATGTGACTTTTTATTTCACATGACATACTGTATATGGTCAGTCTTAGTTTGATTTTATTTTAGCTATGTATATTTCTGAGTAGGTTGGAGTCTATGAGGGATGGTCTGATCGAGCTTCAGATGTCAGTGCCAGCTCTACAGATGGACACCTCTGCCACTGCCACCCTAAAGAAAAACAATGGGCTCGTCCTGCAGCTTGAAACAGCCTTTAACATGCCAGAGACCACATCTGTGCAGAAAGCCATTCTCAGATACGGTAATGATGGCACTCGCTGTTAATAAAACAAACGTTCCTGTAATGAATTTTTCACTGAGATTTGAACTATTTTTACTTTGCAGATAATAACAAGGTTGAAATT[G/T]AAATGAAGTCAGACATAAACTCTGAGGTTGAGAAACTTTTTCCAAATATGGAGGAGTATCGTAGCCAGCTGCAGGCAAGTATTGATGAAATCCTCGACAAGAAAGTCACCAAGACCGACATGAAACTTCGTCACATTGTTTCAAAAGGGTTAGAGGTATGTCGATTATATTTAAATTACACTAATTTGACCATTTCCATTTAAGTGATGAACATTTTATTTGAATGATGTCTTTTTGTCTCTAGGCTGTGAATATTTGGCTGGATAAAATAGCAGCAGGCAGCTCATTTGTGGATGTACAGAGGAACAAGAGAAGCACCCCAGAGCTCATATTGCCATCTTTGCCAGAAAAACTGTATCTTAAATCGTAAGTGACACGTTAATGGACTCCTTAACAATATCTGTTCACATATAGGGGAGATCGGGGCTAGTCACATAAGGAAGTGGTCCCGGGCAATATACAGTGGAGTTAGAGAGCACTTTATGTTACATTTATTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13626
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 1247 4418 23 29
Genomic Location (Zv9):
Chromosome 17 (position 30775578)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30699505
GRCz11 17 30716468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAGAAGCACCCCAGAGCTCATATTGCCATCTTTGCCAGAAAAACTGTA[T/A]CTTAAATCGTAAGTGACACGTTAATGGACTCCTTAACAATATCTGTTCAC
Long Flanking Sequence:
CAGAGACCACATCTGTGCAGAAAGCCATTCTCAGATACGGTAATGATGGCACTCGCTGTTAATAAAACAAACGTTCCTGTAATGAATTTTTCACTGAGATTTGAACTATTTTTACTTTGCAGATAATAACAAGGTTGAAATTGAAATGAAGTCAGACATAAACTCTGAGGTTGAGAAACTTTTTCCAAATATGGAGGAGTATCGTAGCCAGCTGCAGGCAAGTATTGATGAAATCCTCGACAAGAAAGTCACCAAGACCGACATGAAACTTCGTCACATTGTTTCAAAAGGGTTAGAGGTATGTCGATTATATTTAAATTACACTAATTTGACCATTTCCATTTAAGTGATGAACATTTTATTTGAATGATGTCTTTTTGTCTCTAGGCTGTGAATATTTGGCTGGATAAAATAGCAGCAGGCAGCTCATTTGTGGATGTACAGAGGAACAAGAGAAGCACCCCAGAGCTCATATTGCCATCTTTGCCAGAAAAACTGTA[T/A]CTTAAATCGTAAGTGACACGTTAATGGACTCCTTAACAATATCTGTTCACATATAGGGGAGATCGGGGCTAGTCACATAAGGAAGTGGTCCCGGGCAATATACAGTGGAGTTAGAGAGCACTTTATGTTACATTTATTTTATTTTATCTTTGGCTGTACCGTGCTAACTGTATAAGGCCCATGTAGCCTAATAACAAAGCCCAACCCCTGCTGAAGAAAACCTTCCCCAAACCATGACATTTCCTCCTACACCTTTTACTTCTCAACATAATTTCAATTCAGTCTTTTCCTAGTTTGATAATGAACATTAGGTTTTTTTAATTCATTCATTAATTTTCTTTTCGGCTTAGTCCCTTTATTAATCTGTGGTCACCATAGTGGAATGAACTACCCTTAAGGTTTTTTCATCGGACGCAAAATAAATTGTCTTGCTTTAATAACTAAAGTGAGCTTTAGACCAGTTTTCTTTACTCTTTTCCACATGACATGCTTAACAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13822
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 1322 4418 24 29
Genomic Location (Zv9):
Chromosome 17 (position 30777052)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30700979
GRCz11 17 30717942
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATTCCAWCGTTCACAATTCCCCGCACTTTGGAATTCTCCTTACCCATGT[T/A]GGGTGTRGCAGAGCTGTCAGCTAAGATGAACAGCAACTTTTATGAATGGG
Long Flanking Sequence:
AAATATGCTTGAAAACAAACCTTTTCCTACTGGCAAGATATTTTCAGATTAGGTTATTCACTGACTTCTGAATTCTGTAAATTGTATTTTTTTTCTTCTCTACTTTATGTAGACCACGTTCAGGGCATTGAAAGGCATTGATTGCAAAATAATAATCTATTAACAGTTGCCTAACATTTTGTATAAAATAATAAAAATACAGTGACATGTACTAATGTCTGTATACAGTAACTTTACATACATTGATATTGACTGTAATCTTGCTCTCTTCCTCTTTATGTTCAGTGATGCACTGTTGAGATACCAGTTCAACAAAGGCAGAATCTCCATTTCACTTCCTCTTCTCCTGGGAGGAAAGTCATCTGCTGAACTCGACATCCCTCCCACCCTCACGCTCCCACAGATTCAAATTCCCCTCCTTGGCTTGGAAGTTCCTGAGAACAGCTATAAGATTCCAACGTTCACAATTCCCCGCACTTTGGAATTCTCCTTACCCATGT[T/A]GGGTGTAGCAGAGCTGTCAGCTAAGATGAACAGCAACTTTTATGAATGGGAGGGCTCTATCTTAGGGGGCAACAACACTGTTGATGTTCCCAATTACATTGCTAAGTATAAAATAATGGCCAGCTGCCCCTTAACACCCCTGTCATACAAAATTGAAGGTAAGAATCATCAGATTTTAAATAGAAATCATTTTATTTCACTAATATTTATTGTTCTATTTGAATACTTCATCATTATTATTATTGTTTACTTTTTATGCATTTTATTACATTTTATTTAGCATTTATTTATCTATCAATTTTCATCATATATTAAACTTTTTTTTTTTCTTTTCTCTTCACATAGGTATGGGAATGATCTCTGGTACAGTTGATGATACTTTGAAGTACCTCGTAAATGGATCCATCAACCATTGTTTACTCGACGCCAGTATAAGTTTCTTTGAGACTATGAGTTTGGCTGATAAAATCAATGGTAGGACCAACTACCGGCTTGAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8678
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 1726 4418 25 29
Genomic Location (Zv9):
Chromosome 17 (position 30778451)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30702378
GRCz11 17 30719341
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACCATGAGGGGTACTTTGCAAAAAATGAGATCAGAGTGCATGCAAACTT[T/A]GAACATAACTTTATGGACCTTGGCTTTCCGTTCCAAAAHSGACAATTTCA
Long Flanking Sequence:
TGTCAAGAATGGAGAAGCTACATTGAAAGTTGAATCACAGGCAAATGATGCAACACATGATGCATTTTCTCTCCTTACTGGATCACTAAACAGTAACGGCCTCGAAATTAACATGGAAGGTTTGCTGAATTTAGAAAGTGGACGTGGGACACACAAAGGCACACTTTCTTTTGGAGGAAATGGCTTGAGCACTAGTTGCATGACAACTATTGAGGGAAACTCTTTGACTTTTGAGAATGCCTTCAATGGTGGCATCAATGGTGAAGGAGCCTCAGTGTCTGTTGTTTCGAAAGGATCATCACAGGATAACACAATTGAGCTCAGTGCAAAGGGTAAGATTTCACCCAAAGAAGCATCTTTAACCAGTGTTTTTCAAGGGAATGCCTTTGATGGAACTGCAAGAAACACAATGAACATTGGTATTAATAAGCAAGGTCTGAGTATGTCTAATACCATGAGGGGTACTTTGCAAAAAATGAGATCAGAGTGCATGCAAACTT[T/A]GAACATAACTTTATGGACCTTGGCTTTCCGTTCCAAAATGGACAATTTCATTTGTGATGGAGCTTCCTACAATCATGACATCAAGGTTAATATGAGGCCGTTTATCACATCGATAAGTGCAAATAACGAACTTGAGCTTTTTGATTTTGGATTGAGTAGTGATGGGCGCCTTAAGATGGAACCATTTAAGATGGATGTCGCTGGCAGTCTCAGTGGAAAGTATGGAGAAGATGATAGCTTTAATCACGGCTGCGAATTTACTTACGCAGATCTGGCTGGCACCATCAAATGTGATACAGCTGTAAAAGTCTTCGATTCTCATATAAGTAACAGATTCGACTTGGATTTCGCAGGACTGTCTTCGGTAATGAACACCAAGACGCAAGTAAATTGCGAATCTTTACGTCTTGAAAATAACATCCGCACAATGGCCATGCCATTTAGCCTTACAGTTGATGCCATTTTGAACAGTGATGGCACTGTTAATTTTTACGGCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11961
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 2233 4418 25 29
Genomic Location (Zv9):
Chromosome 17 (position 30779972)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30703899
GRCz11 17 30720862
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAGCTGAGTGAACTGAGGAAGGTTGTTGAGACATTTGAWATCAACATGT[T/A]ACTTGARGATCTGAGACAATATATAAYCTCAATTGAYTTGACTGAATAYG
Long Flanking Sequence:
GTTGGATGAATTCCCTCAAAAAGTGAATGACATCATAGTGGACTTGGATTTAGAGAACAAAATCAACAATGTCAAGAATCAGCTGATTTCCCTCATACATGACTATACAATATCAATTGATGACCTTGATGCATATGCTGAAAGATTTAAGGAGGCTACAGGAAAGAAAATTATTGATTTTGCGACCAAAATTAGAGATCTGTCGATTCAAATCAAAGATGGCATTGAAAGTGGAGCATGGGCCAATTCTGTTTCTGACATTTTGGCGCAGATTGGACGTGAACTTAAAGCGTTTGATGAGCAATATAAAATAACTAAAACAATAATCAGAGGCATTGATGGTATTGAAGATGTAATAAGACAGATCGATTTGGAAAAACTGAAGGACAGCAGTGCTACCTGGTTGAAACAGCTGGATGCAAAATATGAAATTAAAACCAAACTTCTGGAAAAGCTGAGTGAACTGAGGAAGGTTGTTGAGACATTTGAAATCAACATGT[T/A]ACTTGAAGATCTGAGACAATATATAACCTCAATTGACTTGACTGAATACGTGGATCAACTGTCTGGTCAAATCCCATATGAGGACATTGAGAGAGTGCTGGATTCTGCAAAAGATGTCATTCTCAATTGGATAGAGGAGTATGAAGTCCCTGAGAAAATCAATAGAGTTTATTTGAATGCACAAGAACTTATTTTACGGTATGAGATTGACAAGAAAATTGAAGTGATCGTCGAGCAGGCCATTATATTAGTCAAACAGTACAGAATCCAAGAGCTGGTGCAGGCTGTAGTGGACACTTTAAAATCGATTCAATTCGAATACATCTCAGATAAAATGATGGAAATCATGGATAGCATAGTTTCTCTGTTAAAGCGTATGGATTTCCAGAAGATTGTAAATGACTTAAATGATTACATTCAGTTGATTATAAAGACCTTTAGAACGTTTGATTACAACACATATATTGATGAAGTAAATAGGAAAGTCAGAGATGTAGTCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28882
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 2414 4418 25 29
Genomic Location (Zv9):
Chromosome 17 (position 30780514)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30704441
GRCz11 17 30721404
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTAGTCGACTATATTAACAAGCAGATAAATGAAGTTTATGAAATTCCA[C/T]GAAAAATAGAGGCATCCAGGGAGTTTATAAAAGAGATGCAGGCGACTGTT
Long Flanking Sequence:
CTGAATACGTGGATCAACTGTCTGGTCAAATCCCATATGAGGACATTGAGAGAGTGCTGGATTCTGCAAAAGATGTCATTCTCAATTGGATAGAGGAGTATGAAGTCCCTGAGAAAATCAATAGAGTTTATTTGAATGCACAAGAACTTATTTTACGGTATGAGATTGACAAGAAAATTGAAGTGATCGTCGAGCAGGCCATTATATTAGTCAAACAGTACAGAATCCAAGAGCTGGTGCAGGCTGTAGTGGACACTTTAAAATCGATTCAATTCGAATACATCTCAGATAAAATGATGGAAATCATGGATAGCATAGTTTCTCTGTTAAAGCGTATGGATTTCCAGAAGATTGTAAATGACTTAAATGATTACATTCAGTTGATTATAAAGACCTTTAGAACGTTTGATTACAACACATATATTGATGAAGTAAATAGGAAAGTCAGAGATGTAGTCGACTATATTAACAAGCAGATAAATGAAGTTTATGAAATTCCA[C/T]GAAAAATAGAGGCATCCAGGGAGTTTATAAAAGAGATGCAGGCGACTGTTTTTGATTATTTGGAGAAACTGAAAAATACACGGATAGCTGAGGTGTGCAGGAACATTAAAGATGTAATCGACACTACTGCATATAAAGACATAAAACTAAAGATTCAGGACATTATCGAGGATGTAAGGCAGAGAATTAGTGACATGGACATCAGAAATGAAATCTCTGTTTACTTAGAAAGGGCAAGTGGAGCTTACGTTAACATGATTGAATACATCTTAACACAGTTCACACAACTCATTGATGAAATGAAGAAGATGGCTGAAGATAAGGAAATTCTTGATCAAATCAGTCAAGCTGTGGAGGGAGTTTTCAATGCTCTAAAAACAGCAGAATTTGATGTACCCGCTTTTATGCTTCCATTCACAACTCTTGAGATTCCTGCCTTTAAGATTAAAATGGCAAGGATACATGATATTACAATTCCAGCAATGATAACAATACCAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2934
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 3013 4418 25 29
Genomic Location (Zv9):
Chromosome 17 (position 30782311)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30706238
GRCz11 17 30723201
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAACAGTAAAATTAWCTTGCCCCTCAAGCTGACTGGAAAAATYGACCTC[C/T]AGGATGACTTTGGATTTACTTTAAATTCCAATAAGCAACATGCATTTTGG
Long Flanking Sequence:
TTGAATCAGGGACTATATCTTTGACCGTTGGAACAGTGGGAAGCGGGAAGTGGTCTCCATCTAATCCATCAAGAACCGTCAAGTCCATTGATGACTATTCTGATGAAATTACACACAAGAGCGATTTTGAGATCACTGTCAATGCTGGCACAGCAAAGCTGAATTTTGATGGTGAAACAAATAGCAGAAACCTTAAAATGAAGCAGTCGGTTAGCGCAGAGTCTGTAATCCTAAGCCACATAACCATCGATGCCAGGGCTGAAACCGAGGCGCCCTTCTTAAAGGGCAGTGTTTTGACACTCAAAGTAAAAGCTCAAATGGAAGATGTCCGAATGGAAATAGAAATTTCACATAGTGCTGATCTTATTGGAAAAGTAAGTGGAAGCATATCCAACACGTGTGACTTTTTGGCTCAGCCATTTGAAGTCACACTTGACTGCAGAAATAAAGGAAACAGTAAAATTATCTTGCCCCTCAAGCTGACTGGAAAAATTGACCTC[C/T]AGGATGACTTTGGATTTACTTTAAATTCCAATAAGCAACATGCATTTTGGGTAGGTCTCGCTCGCTTCAACCAGTACAAATACAAACACAACTTGACCTTTGATAACAATGAAAATGAAGCTGGAATCTACACTTCAGTTGATTGCGAAGCCAATCTTGAATTCCTGACTGTTCCCATCAGTATCCCAGAAATTCCAATCCCATACCTGGGTATAAAAACACCCAAAATCAATGAGTTTTCTTTTTGGGAGGATTATAGACTGAAAGATCTTCTGACCACTCCTAAACAAACAATTGATATTGACTTCAAACTATTGTATCAGAAAAACCCAGAGAAGCACACATTTGATCTAAACCTTGAGCCAATTTATGAAGCCTTCAATGAAAATGCCAAGATTTTAAGACTGCATTTTGAACTTGGAAGAGACCATATTTTTGATGCCCTCACTAATTCCTACAACCAAGCCAGAATTCAGCATGAAAAGTATAAAATTGATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6482
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Nonsense 3431 4418 25 29
Genomic Location (Zv9):
Chromosome 17 (position 30783567)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30707494
GRCz11 17 30724457
KASP Assay ID:
554-5449.1 (used for ordering genotyping assays)
KASP Sequence:
GGAACTGGAAGCATTGATCACAATTTTGCCCTAGAGGCACTGTCATCCTA[T/G]ATCTCTTTGGAGAGCRCTTGGAAAGGAACAACAGATTCAACAATCATGGW
Long Flanking Sequence:
CCAGATATTCAGAATAATATCATGATACCTGCATTTGGAAATTTGACCTATGAATTCTCAATCAAATCTCCAGTATTATCTCTGAATTCCAATGGTGGCCTATATAATCATTCAGACATGGTGATCAAGTTTGATGTCTCGTCTACATCTGTGTTTGATGTTCTCAAAGGTAAACTTGATGGCAGTGCCACTATCAACAAAAGGAGAGGACTGAAGATGGCAACTAGCCTGTCTTTGGTTCACATGTGTGCTGAATGTAGTCATGAGAGCACTGTGAGTCTCACAAAGAGGAATATGGAAGCTTCTTTAACAAACCTTGCTAAAATTAAGTGCCCGGTTCTTATGATGGACTTAAATCAAGTACTTCGCGGAAATACAAAGTCTAAACCAAATATCGCCTCTAATATTAAAGTGAGCTACTCTTATGATTTGCCCATAATCGAAACACAGGGAACTGGAAGCATTGATCACAATTTTGCCCTAGAGGCACTGTCATCCTA[T/G]ATCTCTTTGGAGAGCGCTTGGAAAGGAACAACAGATTCAACAATCATGGAAAGTGGAAATCTGGCTGCATCTTTGAATAATGAAGTAACCATTTACTTGAATGCCAATGGTCTTCGTTCCACGCTGAAAACTGATGTGAACTCTAAAGTCTACCACCAAAAAGCTGGTTCCTGGAATATTGATGTCACTAAGAACCTTGCCCTTGAGGCCTCTCTGCGACGTATTTATGCTACAATGGCCTACACAAGTAGTAATGCAGCTAGTATTGCATCGTTTTCAACTAATGGAAAGCAAAACGTGAGGGCTACACTTGAGTTTGTTCCATTGACAACTTTGTCTGCTAATCTTGATATTGACATTTCACAGCCAACTAACTATGGTCATGCTGGTATAGTGGAGAACATAGATCTTTCCATCACTTCAGACAAGCAAAGATTTCTTTGGAGTGGCAAGGAACAACTTGCAACTCTTATCCATTCTGCTGATCTGATACTATCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36451
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062793 Essential Splice Site 3902 4418 25 29
Genomic Location (Zv9):
Chromosome 17 (position 30784982)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30708909
GRCz11 17 30725872
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGTCCACCTGCACTTCCACCATGGTTTTCCTGGAGTACAACTTAGATG[G/A]TAAGCTTTAAAGACTTTTACAAGTTTATAAGGATCTATATTACTGTGTAT
Long Flanking Sequence:
CTTTGTTATTGATTTGACAAATCTAGAAGTCCCCAATGAAATCAGCACACCTTCCTTTGACATAATGTTGCCGGGTTTACCAAAAGTGGAAATCCCTAGCATTAATGCTAGAACAAAATATCTGAAAGACAAAATGGCTCATTTGTTTGTCAGTTTGCCACAGTATGAAATCACCATATCACCATTTAACCTTCCCAAAGCATTCGACATTGGCGACTACCCAATACGTTTGGATGACATCACAAACACACTATATCATTTTGAATTGCCAACTATTATTATCCCTGAACAAAAAATCGATGTCCCAGAGATATCTCTCCATCTCCCAGCTGGTGTGTTTATTCCAAAATTCGGTGACCTATCAGCCACTTTCAAAATGGCTTCCCCAATTTATAACAACACATGGACTGGAAATGTAGAAAACACAGAGGCAGGAACTGTTTGCACATTGAAGTCCACCTGCACTTCCACCATGGTTTTCCTGGAGTACAACTTAGATG[G/A]TAAGCTTTAAAGACTTTTACAAGTTTATAAGGATCTATATTACTGTGTATTTATTTTTATGTAACATTACATTTTTAGCAATTGCCACAATCCTTCTTGAGAATGGGGCTTTGGGTCTAGATGCAAAAAGTACTTTCAACCATCGTGATATGAATATAAACTGGAAGCATGATCTGCGTCAGAATCTAAGGTAATAAAATAACATGTATTTCTCAAACCTACACATTTAGAAAGTCTCCTAAAATAATTTACAAATAATTTCTGTTGTTTTTCCAGAATGAAGCGCGATGAGTCTTCAGTTTCCCGGTAATTTCCTGACTTTCTTATTGACATAAAATTTTATTCATTACAGTATTGCAAAACTAATGTTACTGTAAATGCATTTTTACTCCACAGTCCCTCACGACATACGCTGGGCATTGACATTGCAAGCCAGACATTTTCTGATGTGAGCTTTCGCTATGCATCACACAACAATGGGATCACGTCTTCAGTATCCT
Associated Phenotype:
Not determined