Busch Lab

ZMP

cnst

Ensembl ID:
ENSDARG00000042759
ZFIN ID:
ZDB-GENE-041001-189
Description:
consortin, connexin sorting protein [Source:RefSeq peptide;Acc:NP_001020712]
Human Orthologue:
CNST
Human Description:
consortin, connexin sorting protein [Source:HGNC Symbol;Acc:26486]
Mouse Orthologue:
Cnst
Mouse Description:
consortin, connexin sorting protein Gene [Source:MGI Symbol;Acc:MGI:2445141]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa45710 Nonsense Mutation detected in F1 DNA Not yet available
sa43491 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16439 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45710
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062761 Nonsense 84 398 3 10
Genomic Location (Zv9):
Chromosome 20 (position 35032063)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35104576
GRCz11 20 35007455
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCATGCGGTGATCTCTCTCTTTCTGTTCAGAGGGTCTTCCTGGGATTT[T/A]GGCACCTGGACCAAGTCCTTCTCTTCTGGCTTCACTGCATGCTCTGGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43491
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062761 Essential Splice Site 200 398 7 10
Genomic Location (Zv9):
Chromosome 20 (position 35024878)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35097391
GRCz11 20 35000270
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAATAATCTGACAAAACTTTCTTTCAGACCAAACCTCTCTGTGCAAAAG[G/A]TAAAACATTACAACTTCCTTATTCTCCTCCAATGCATTTTATTTTCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16439
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062761 Nonsense 380 398 10 10
Genomic Location (Zv9):
Chromosome 20 (position 35016425)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35088938
GRCz11 20 34991817
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTACTCGAATGTGTGCATCGACTTCTCTCAGAACATGGACTTTTACTTT[G/T]GACCTGTASGACRAACAGTGRCTGCTCTTACACAGTGGTTCACTTCTGGT
Associated Phenotype:
Not determined