Busch Lab

ZMP

si:ch211-282j17.11

Ensembl ID:
ENSDARG00000042752
ZFIN ID:
ZDB-GENE-041210-284
Description:
hypothetical protein LOC557100 [Source:RefSeq peptide;Acc:NP_001025280]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa33997 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33997
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064240 None None 250 None 3
ENSDART00000136711 None None 250 None 4
ENSDART00000137140 Nonsense 220 366 4 5
Genomic Location (Zv9):
Chromosome 7 (position 3929918)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 3620332
GRCz11 7 3756344
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATACTGGGATACTACTCAACCTGATAATCAAGGAGGCATTGAAAACTG[T/A]GTAGGAATAAGTCTGTATGTTCAGGGAAAATGGCATGACATCTCCTGCAC
Associated Phenotype:
Not determined